Incidental Mutation 'R5434:Frmd3'
ID428200
Institutional Source Beutler Lab
Gene Symbol Frmd3
Ensembl Gene ENSMUSG00000049122
Gene NameFERM domain containing 3
Synonyms4.1O, EPB41L4O, P410, 9430066I12Rik
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location74013442-74202214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74187796 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 560 (I560F)
Ref Sequence ENSEMBL: ENSMUSP00000081514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084474] [ENSMUST00000098006]
Predicted Effect probably damaging
Transcript: ENSMUST00000084474
AA Change: I560F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081514
Gene: ENSMUSG00000049122
AA Change: I560F

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098006
SMART Domains Protein: ENSMUSP00000095615
Gene: ENSMUSG00000049122

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154134
Meta Mutation Damage Score 0.3459 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single pass membrane protein primarily found in ovaries. A similar protein in erythrocytes helps determine the shape of red blood cells, but the function of the encoded protein has not been determined. There is some evidence that this is a tumor suppressor gene, and there is also evidence linking defects in this gene to susceptibility to diabetic nephropathy in type 1 diabetes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Frmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Frmd3 APN 4 74074120 missense possibly damaging 0.62
IGL01774:Frmd3 APN 4 74187838 missense probably damaging 1.00
IGL02213:Frmd3 APN 4 74135872 missense probably benign 0.36
IGL02479:Frmd3 APN 4 74187515 missense probably benign 0.30
IGL03248:Frmd3 APN 4 74128218 missense possibly damaging 0.71
R0765:Frmd3 UTSW 4 74161767 missense probably damaging 1.00
R1411:Frmd3 UTSW 4 74153621 missense probably damaging 1.00
R1535:Frmd3 UTSW 4 74013758 start gained probably benign
R1990:Frmd3 UTSW 4 74187439 missense probably damaging 1.00
R3898:Frmd3 UTSW 4 74074109 missense probably damaging 1.00
R4377:Frmd3 UTSW 4 74128298 critical splice donor site probably null
R4616:Frmd3 UTSW 4 74187872 missense probably benign 0.15
R4965:Frmd3 UTSW 4 74153600 missense probably damaging 1.00
R5024:Frmd3 UTSW 4 74098144 missense probably benign 0.00
R5104:Frmd3 UTSW 4 74145078 missense probably damaging 1.00
R5418:Frmd3 UTSW 4 74161698 critical splice acceptor site probably null
R5878:Frmd3 UTSW 4 74153610 missense probably damaging 1.00
R5999:Frmd3 UTSW 4 74170691 missense possibly damaging 0.49
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6616:Frmd3 UTSW 4 74187488 missense probably damaging 0.97
R6813:Frmd3 UTSW 4 74159245 missense probably benign 0.00
R6941:Frmd3 UTSW 4 74098126 missense probably benign 0.20
R7233:Frmd3 UTSW 4 74013786 missense probably benign 0.09
R7334:Frmd3 UTSW 4 74161718 missense probably benign 0.02
R7429:Frmd3 UTSW 4 74145105 missense probably damaging 0.98
R7430:Frmd3 UTSW 4 74145105 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCCAAGCTTTGTCATGGAG -3'
(R):5'- GGTTTGAGCAGTCAGTTAAGAG -3'

Sequencing Primer
(F):5'- ATGGAGCTATTCAATCCTGACCGG -3'
(R):5'- GACTACCTCTTGACAACTGAAGG -3'
Posted On2016-09-01