Incidental Mutation 'R5434:Ltbr'
ID428206
Institutional Source Beutler Lab
Gene Symbol Ltbr
Ensembl Gene ENSMUSG00000030339
Gene Namelymphotoxin B receptor
SynonymsTNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Tnfrsf3, Ltar
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125306571-125313885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125312794 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 146 (R146W)
Ref Sequence ENSEMBL: ENSMUSP00000032489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032489]
Predicted Effect probably damaging
Transcript: ENSMUST00000032489
AA Change: R146W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032489
Gene: ENSMUSG00000030339
AA Change: R146W

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
TNFR 43 80 5.73e-5 SMART
TNFR 83 124 3.96e-8 SMART
Blast:TNFR 126 169 3e-7 BLAST
TNFR 172 212 1.95e-7 SMART
transmembrane domain 222 244 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 362 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161891
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Ltbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03349:Ltbr APN 6 125312366 missense probably damaging 0.96
armitage UTSW 6 125312794 missense probably damaging 0.97
bonsai UTSW 6 125312770 missense probably damaging 1.00
kama UTSW 6 125313388 critical splice donor site probably null
marine_blue UTSW 6 125312808 missense probably damaging 0.98
moksha UTSW 6 125308068 missense probably benign 0.00
Questionable UTSW 6 125313375 splice site probably benign
R0090:Ltbr UTSW 6 125309449 splice site probably benign
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0553:Ltbr UTSW 6 125313388 critical splice donor site probably null
R0686:Ltbr UTSW 6 125308061 missense possibly damaging 0.88
R0879:Ltbr UTSW 6 125313375 splice site probably benign
R1086:Ltbr UTSW 6 125312740 splice site probably benign
R2118:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2120:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2122:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2124:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2199:Ltbr UTSW 6 125312061 missense probably benign 0.25
R4931:Ltbr UTSW 6 125307474 splice site probably null
R5051:Ltbr UTSW 6 125312770 missense probably damaging 1.00
R5174:Ltbr UTSW 6 125309537 missense probably benign 0.00
R5268:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5269:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5357:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5358:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5360:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5361:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5363:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5436:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5441:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5442:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5533:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5534:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5859:Ltbr UTSW 6 125312808 missense probably damaging 0.98
R6217:Ltbr UTSW 6 125307454 missense probably damaging 1.00
R6702:Ltbr UTSW 6 125308068 missense probably benign 0.00
R7101:Ltbr UTSW 6 125312800 missense probably benign 0.00
R7584:Ltbr UTSW 6 125307241 missense probably benign 0.09
R7587:Ltbr UTSW 6 125312352 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATACCAGTTCATGTCTTGGC -3'
(R):5'- TGCATGATGGGTACGACTGG -3'

Sequencing Primer
(F):5'- GACTGATAGATTCTTTATGGTTCTCC -3'
(R):5'- TACGACTGGGAGGGCCAG -3'
Posted On2016-09-01