Incidental Mutation 'R5434:Sars2'
ID428209
Institutional Source Beutler Lab
Gene Symbol Sars2
Ensembl Gene ENSMUSG00000070699
Gene Nameseryl-aminoacyl-tRNA synthetase 2
Synonyms2410015F05Rik, D7Ertd353e
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R5434 (G1)
Quality Score126
Status Validated
Chromosome7
Chromosomal Location28741992-28753871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28750291 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 387 (R387Q)
Ref Sequence ENSEMBL: ENSMUSP00000092216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094632] [ENSMUST00000094632] [ENSMUST00000207877]
Predicted Effect probably null
Transcript: ENSMUST00000094632
AA Change: R387Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699
AA Change: R387Q

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094632
AA Change: R387Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699
AA Change: R387Q

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207897
Meta Mutation Damage Score 0.5023 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Sars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Sars2 APN 7 28753423 unclassified probably benign
IGL01376:Sars2 APN 7 28749883 missense probably damaging 1.00
IGL01633:Sars2 APN 7 28747549 missense probably benign 0.02
IGL02121:Sars2 APN 7 28752525 unclassified probably benign
IGL02488:Sars2 APN 7 28742160 nonsense probably null
IGL03062:Sars2 APN 7 28746781 missense possibly damaging 0.89
R1601:Sars2 UTSW 7 28748971 missense probably benign 0.26
R1857:Sars2 UTSW 7 28750012 missense probably benign 0.00
R1859:Sars2 UTSW 7 28744312 missense probably damaging 0.99
R2193:Sars2 UTSW 7 28748997 missense probably damaging 0.96
R2204:Sars2 UTSW 7 28749674 missense possibly damaging 0.95
R4452:Sars2 UTSW 7 28750093 missense probably benign 0.08
R4514:Sars2 UTSW 7 28742284 critical splice donor site probably null
R4921:Sars2 UTSW 7 28752438 missense possibly damaging 0.81
R5121:Sars2 UTSW 7 28747908 missense probably damaging 0.99
R5849:Sars2 UTSW 7 28744258 missense possibly damaging 0.92
R6668:Sars2 UTSW 7 28747004 missense probably benign 0.01
R7123:Sars2 UTSW 7 28753441 missense probably benign 0.40
R7205:Sars2 UTSW 7 28744308 missense probably benign
R7677:Sars2 UTSW 7 28746751 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCACTAAGGTGAGTAGTGTAGGC -3'
(R):5'- CTCTAAAGACTGGGAGCTTGG -3'

Sequencing Primer
(F):5'- TGAGTAGTGTAGGCCTGGC -3'
(R):5'- GGTTGGCCTTGAACTCAGAAATCC -3'
Posted On2016-09-01