Incidental Mutation 'R5434:Ces2a'
ID428213
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Namecarboxylesterase 2A
SynonymsCes6, 9130231C15Rik
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104734003-104741634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104737409 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 224 (F224L)
Ref Sequence ENSEMBL: ENSMUSP00000127346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
Predicted Effect probably damaging
Transcript: ENSMUST00000034346
AA Change: F224L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: F224L

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably damaging
Transcript: ENSMUST00000164182
AA Change: F224L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: F224L

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Meta Mutation Damage Score 0.3459 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 104741415 makesense probably null
IGL02135:Ces2a APN 8 104740181 missense probably benign 0.00
IGL02529:Ces2a APN 8 104737219 splice site probably benign
IGL02625:Ces2a APN 8 104740278 critical splice donor site probably null
IGL02869:Ces2a APN 8 104739059 missense probably damaging 1.00
IGL03265:Ces2a APN 8 104737443 missense possibly damaging 0.55
IGL03349:Ces2a APN 8 104734080 missense probably damaging 0.99
R0010:Ces2a UTSW 8 104741396 missense probably benign 0.00
R0318:Ces2a UTSW 8 104740824 missense probably damaging 1.00
R0477:Ces2a UTSW 8 104737537 missense probably damaging 0.99
R0561:Ces2a UTSW 8 104737533 missense probably benign 0.35
R0619:Ces2a UTSW 8 104736110 missense probably benign 0.00
R1665:Ces2a UTSW 8 104737555 splice site probably benign
R1737:Ces2a UTSW 8 104740824 missense probably damaging 0.98
R2266:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2267:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2269:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2288:Ces2a UTSW 8 104737437 missense probably damaging 1.00
R2656:Ces2a UTSW 8 104736134 missense probably benign 0.00
R3176:Ces2a UTSW 8 104739378 splice site probably benign
R3906:Ces2a UTSW 8 104739308 missense probably benign 0.00
R4344:Ces2a UTSW 8 104737134 missense probably damaging 1.00
R4708:Ces2a UTSW 8 104737306 missense probably benign 0.14
R4780:Ces2a UTSW 8 104737208 missense probably damaging 1.00
R5763:Ces2a UTSW 8 104736124 missense probably benign 0.00
R5828:Ces2a UTSW 8 104739324 missense probably benign 0.00
R6359:Ces2a UTSW 8 104736078 missense probably benign 0.00
R6440:Ces2a UTSW 8 104741322 missense probably benign 0.12
R7066:Ces2a UTSW 8 104740248 missense probably damaging 0.99
R7267:Ces2a UTSW 8 104739040 missense probably benign 0.20
R7395:Ces2a UTSW 8 104739641 missense probably benign 0.35
R7455:Ces2a UTSW 8 104737522 missense probably damaging 1.00
R7457:Ces2a UTSW 8 104737389 missense possibly damaging 0.87
R7567:Ces2a UTSW 8 104741298 missense probably benign 0.01
R7683:Ces2a UTSW 8 104737112 missense probably benign 0.00
X0022:Ces2a UTSW 8 104736142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTTCTTCAGGTAAGCC -3'
(R):5'- AGCCCCAAAGACTGAGGTAG -3'

Sequencing Primer
(F):5'- CTGGGACTGGGCTGTGTAAAAG -3'
(R):5'- AGCAAAGTAGGGGCTGTTGTTC -3'
Posted On2016-09-01