Incidental Mutation 'R5434:Sf3a1'
ID428220
Institutional Source Beutler Lab
Gene Symbol Sf3a1
Ensembl Gene ENSMUSG00000002129
Gene Namesplicing factor 3a, subunit 1
Synonyms
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4160350-4182541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4174041 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 296 (P296Q)
Ref Sequence ENSEMBL: ENSMUSP00000002198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002198]
PDB Structure
Solution structure of Ubiquitin-like domain in SF3a120 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000002198
AA Change: P296Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002198
Gene: ENSMUSG00000002129
AA Change: P296Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SWAP 50 103 4.99e-30 SMART
low complexity region 118 138 N/A INTRINSIC
SWAP 164 217 3.22e-24 SMART
Pfam:PRP21_like_P 227 469 7e-81 PFAM
low complexity region 552 560 N/A INTRINSIC
low complexity region 574 589 N/A INTRINSIC
low complexity region 624 673 N/A INTRINSIC
UBQ 713 784 6.52e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133095
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Sf3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sf3a1 APN 11 4171063 missense probably damaging 1.00
IGL02883:Sf3a1 APN 11 4179192 missense probably damaging 1.00
IGL03061:Sf3a1 APN 11 4175493 missense probably damaging 1.00
R1469:Sf3a1 UTSW 11 4175380 splice site probably benign
R1561:Sf3a1 UTSW 11 4179217 missense probably benign
R1905:Sf3a1 UTSW 11 4176678 missense probably benign 0.01
R1993:Sf3a1 UTSW 11 4179177 missense possibly damaging 0.51
R2264:Sf3a1 UTSW 11 4177443 missense probably benign 0.28
R3935:Sf3a1 UTSW 11 4180024 splice site probably null
R3936:Sf3a1 UTSW 11 4180024 splice site probably null
R4065:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4067:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4245:Sf3a1 UTSW 11 4167774 missense probably damaging 1.00
R5167:Sf3a1 UTSW 11 4177456 missense possibly damaging 0.71
R7471:Sf3a1 UTSW 11 4167724 missense possibly damaging 0.94
R7506:Sf3a1 UTSW 11 4177561 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGGGTGGCCTCTTTTCTTC -3'
(R):5'- ATGTCCTGTACTTGAGTATCCTGG -3'

Sequencing Primer
(F):5'- GCCATCACACAGGGTCTATATGTAG -3'
(R):5'- GTACTTGAGTATCCTGGTCCAGC -3'
Posted On2016-09-01