Incidental Mutation 'R5434:Bop1'
ID428229
Institutional Source Beutler Lab
Gene Symbol Bop1
Ensembl Gene ENSMUSG00000022557
Gene Nameblock of proliferation 1
SynonymsErb1p
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76452989-76477277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76455411 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 245 (M245V)
Ref Sequence ENSEMBL: ENSMUSP00000023217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023217] [ENSMUST00000043089] [ENSMUST00000096385]
Predicted Effect probably benign
Transcript: ENSMUST00000023217
AA Change: M245V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023217
Gene: ENSMUSG00000022557
AA Change: M245V

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
BOP1NT 130 388 1.38e-177 SMART
WD40 388 427 1.16e-9 SMART
WD40 430 469 6.16e0 SMART
WD40 508 551 7.1e1 SMART
WD40 554 592 4.46e-1 SMART
WD40 595 634 2.76e-2 SMART
WD40 638 677 4.14e-6 SMART
WD40 689 732 3.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043089
SMART Domains Protein: ENSMUSP00000043668
Gene: ENSMUSG00000034161

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
low complexity region 45 80 N/A INTRINSIC
HLH 84 136 1.46e-16 SMART
low complexity region 161 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096385
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160986
Predicted Effect probably benign
Transcript: ENSMUST00000161265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229897
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Bop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Bop1 APN 15 76454528 missense probably benign 0.04
IGL01085:Bop1 APN 15 76453376 missense probably damaging 1.00
IGL02157:Bop1 APN 15 76455572 missense possibly damaging 0.70
R0332:Bop1 UTSW 15 76455987 missense probably damaging 1.00
R2148:Bop1 UTSW 15 76455287 missense probably damaging 0.96
R3979:Bop1 UTSW 15 76453876 missense probably damaging 1.00
R4133:Bop1 UTSW 15 76454335 missense probably benign 0.24
R5396:Bop1 UTSW 15 76455289 missense probably damaging 1.00
R5666:Bop1 UTSW 15 76454233 missense probably benign 0.00
R5820:Bop1 UTSW 15 76454841 missense probably damaging 1.00
R5883:Bop1 UTSW 15 76454849 missense probably damaging 1.00
R5907:Bop1 UTSW 15 76455917 missense probably damaging 1.00
R6807:Bop1 UTSW 15 76454983 missense probably damaging 0.99
R6947:Bop1 UTSW 15 76453988 missense probably damaging 1.00
R7232:Bop1 UTSW 15 76453346 missense probably damaging 1.00
R7395:Bop1 UTSW 15 76453841 missense probably damaging 1.00
R7477:Bop1 UTSW 15 76455326 missense probably damaging 1.00
R7725:Bop1 UTSW 15 76455383 missense probably benign 0.23
R7792:Bop1 UTSW 15 76454348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTAAGACTCGGCATGGC -3'
(R):5'- TCTGAAGTCCATGAACGCC -3'

Sequencing Primer
(F):5'- CAACACAGCATTCGGATC -3'
(R):5'- CAGCTGTGGACTTCTTCAGCG -3'
Posted On2016-09-01