Mutagenetix > Incidental Mutations

Incidental Mutation 'R5435:Col4a4'

428239

Institutional Source

Beutler Lab

Gene Symbol

Col4a4

Ensembl Gene

ENSMUSG00000067158

Gene Name

collagen, type IV, alpha 4

Synonyms

E130010M05Rik, [a]4(IV)

MMRRC Submission

043000-MU

Accession Numbers

Genbank: NM_007735; MGI: 104687

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R5435 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82448423-82586849 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 82454007 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1519 (I1519F)

Ref Sequence

ENSEMBL: ENSMUSP00000084282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087050]

Predicted Effect

unknown
Transcript: ENSMUST00000087050
AA Change: I1519F

SMART Domains

Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: I1519F

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
Pfam:Collagen	54	113	4e-11	PFAM
Pfam:Collagen	110	168	4.1e-10	PFAM
Pfam:Collagen	172	229	2.8e-10	PFAM
low complexity region	265	288	N/A	INTRINSIC
internal_repeat_7	289	345	1.46e-9	PROSPERO
internal_repeat_6	291	348	5.03e-10	PROSPERO
internal_repeat_9	297	353	7.22e-9	PROSPERO
internal_repeat_4	322	354	2.06e-11	PROSPERO
internal_repeat_11	334	349	1.25e-5	PROSPERO
Pfam:Collagen	392	449	1.3e-8	PFAM
low complexity region	461	482	N/A	INTRINSIC
Pfam:Collagen	486	553	1e-10	PFAM
low complexity region	563	595	N/A	INTRINSIC
Pfam:Collagen	597	658	1e-8	PFAM
Pfam:Collagen	663	731	4.4e-10	PFAM
Pfam:Collagen	755	810	3.3e-9	PFAM
internal_repeat_2	816	841	2.9e-13	PROSPERO
Pfam:Collagen	844	912	1.8e-10	PFAM
Pfam:Collagen	898	962	2.7e-10	PFAM
low complexity region	963	1003	N/A	INTRINSIC
Pfam:Collagen	1006	1071	2e-10	PFAM
Pfam:Collagen	1073	1132	5.8e-12	PFAM
Pfam:Collagen	1124	1185	1.8e-10	PFAM
Pfam:Collagen	1187	1245	2.3e-8	PFAM
low complexity region	1277	1361	N/A	INTRINSIC
low complexity region	1371	1384	N/A	INTRINSIC
Pfam:Collagen	1395	1454	4.3e-8	PFAM
C4	1457	1564	3.36e-58	SMART
C4	1565	1681	1.49e-59	SMART

Meta Mutation Damage Score

0.1486

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,741,250		probably benign	Het
3425401B19Rik	A	G	14: 32,661,456	F851L	probably benign	Het
Abca17	C	T	17: 24,267,614	V1480I	possibly damaging	Het
Acsbg1	G	T	9: 54,615,869	Y491*	probably null	Het
Acsf3	T	A	8: 122,780,281	N104K	probably damaging	Het
Adam23	T	C	1: 63,546,453	Y400H	possibly damaging	Het
Adgra3	G	A	5: 49,990,126	T524M	probably damaging	Het
Aff1	G	A	5: 103,754,332		probably benign	Het
Anxa9	T	C	3: 95,297,250	Y321C	probably damaging	Het
Ap1g1	T	A	8: 109,838,920	Y329N	probably damaging	Het
Aph1c	A	T	9: 66,834,501	I33N	possibly damaging	Het
B3galnt2	A	G	13: 13,996,990	E491G	probably benign	Het
Bdh1	C	T	16: 31,456,657	R235C	probably damaging	Het
Ccar2	A	G	14: 70,139,327	L856P	probably damaging	Het
Ccdc107	A	T	4: 43,493,519	D30V	probably damaging	Het
Ccdc116	G	T	16: 17,142,762	H64N	probably benign	Het
Ccl12	T	C	11: 82,103,175	I86T	possibly damaging	Het
Col2a1	T	C	15: 98,000,510		probably benign	Het
Ddx19b	T	C	8: 111,008,826	Q416R	possibly damaging	Het
Dnah6	T	A	6: 73,060,138	M3374L	probably benign	Het
Dnajc6	A	T	4: 101,606,610	I119F	probably damaging	Het
Ensa	C	A	3: 95,622,458		probably benign	Het
Fbxo4	C	T	15: 3,965,792	V357I	possibly damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Foxf1	G	A	8: 121,084,492	G32S	probably damaging	Het
Gls2	G	A	10: 128,195,126		probably benign	Het
Gm13599	T	A	2: 67,396,152		noncoding transcript	Het
Gmnn	A	G	13: 24,752,101	S197P	probably benign	Het
Guf1	A	T	5: 69,563,169	H324L	probably benign	Het
H2-Q6	A	G	17: 35,425,685	D150G	probably damaging	Het
Herc3	T	A	6: 58,855,806	L152Q	probably damaging	Het
Hnrnpul2	T	G	19: 8,820,318	S13A	probably benign	Het
Ighv5-4	A	G	12: 113,597,663	F46L	probably benign	Het
Kank1	T	G	19: 25,411,143	S727A	probably benign	Het
Kcnma1	A	T	14: 23,528,404	Y201*	probably null	Het
Lyst	A	T	13: 13,777,064	H3750L	possibly damaging	Het
Mettl25	A	G	10: 105,779,586		probably null	Het
Mpdz	A	G	4: 81,283,487		probably benign	Het
Myh9	C	T	15: 77,769,609	V1280I	probably benign	Het
Neto1	A	T	18: 86,398,263	T32S	probably benign	Het
Nol7	C	A	13: 43,401,372	H187Q	possibly damaging	Het
Olfr992	T	A	2: 85,400,470	N21I	probably benign	Het
Pcdha8	A	G	18: 36,993,599	D378G	probably damaging	Het
Peak1	A	G	9: 56,206,486	S694P	probably damaging	Het
Pih1d1	T	A	7: 45,156,272		probably null	Het
Pik3c2g	T	G	6: 139,715,855		probably null	Het
Prkar2a	A	G	9: 108,740,483	R247G	probably damaging	Het
Psg26	A	G	7: 18,478,473	I319T	possibly damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa3	T	C	8: 13,631,811	E46G	possibly damaging	Het
Rbbp5	T	A	1: 132,494,275	H304Q	probably damaging	Het
Scn1a	T	A	2: 66,273,534	E1783V	probably damaging	Het
Stag1	A	G	9: 100,953,550	N151S	probably benign	Het
Tbc1d32	C	A	10: 56,040,150	A1191S	probably damaging	Het
Tchh	C	A	3: 93,443,672	R140S	possibly damaging	Het
Trank1	A	G	9: 111,391,890	Y2565C	probably benign	Het
Ttn	A	T	2: 76,914,358	V5449D	probably damaging	Het
Tubgcp2	G	A	7: 139,996,072	P893S	possibly damaging	Het
Wdfy4	A	G	14: 33,020,311	F2325S	probably damaging	Het
Wdr35	A	G	12: 8,989,951	D352G	probably benign	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Ypel3	A	G	7: 126,775,788		probably benign	Het
Zan	T	A	5: 137,403,762	T4023S	unknown	Het
Zfp735	T	A	11: 73,712,113	C628S	possibly damaging	Het

Other mutations in Col4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Col4a4	APN	1	82491641	missense	unknown
IGL01092:Col4a4	APN	1	82466545	missense	unknown
IGL01104:Col4a4	APN	1	82466545	missense	unknown
IGL01413:Col4a4	APN	1	82471248	missense	unknown
IGL01518:Col4a4	APN	1	82455759	missense	unknown
IGL02014:Col4a4	APN	1	82523960	splice site	probably benign
IGL02215:Col4a4	APN	1	82453809	missense	unknown
IGL02707:Col4a4	APN	1	82493516	missense	unknown
IGL02858:Col4a4	APN	1	82528483	missense	unknown
IGL02987:Col4a4	APN	1	82498925	splice site	probably benign
IGL03384:Col4a4	APN	1	82484438	missense	probably benign	0.04
amazement	UTSW	1	82480486	nonsense	probably null
aoba	UTSW	1	82535740	critical splice donor site	probably benign
asombro	UTSW	1	82489009	critical splice donor site	probably null
astonishment	UTSW	1	82455728	missense	unknown
wonderment	UTSW	1	82453144	missense	unknown
IGL02980:Col4a4	UTSW	1	82469477	critical splice donor site	probably null
R0028:Col4a4	UTSW	1	82487510	critical splice donor site	probably null
R0083:Col4a4	UTSW	1	82507111	critical splice acceptor site	probably null
R0696:Col4a4	UTSW	1	82492549	missense	unknown
R0788:Col4a4	UTSW	1	82524996	missense	unknown
R0789:Col4a4	UTSW	1	82524996	missense	unknown
R0790:Col4a4	UTSW	1	82524996	missense	unknown
R0894:Col4a4	UTSW	1	82529656	splice site	probably null
R1217:Col4a4	UTSW	1	82489009	critical splice donor site	probably null
R1465:Col4a4	UTSW	1	82497822	splice site	probably null
R1465:Col4a4	UTSW	1	82497822	splice site	probably null
R1474:Col4a4	UTSW	1	82480486	nonsense	probably null
R1508:Col4a4	UTSW	1	82455836	missense	unknown
R1640:Col4a4	UTSW	1	82535770	missense	unknown
R1678:Col4a4	UTSW	1	82486659	missense	unknown
R1827:Col4a4	UTSW	1	82539988	missense	unknown
R1930:Col4a4	UTSW	1	82466600	splice site	probably null
R1931:Col4a4	UTSW	1	82466600	splice site	probably null
R2092:Col4a4	UTSW	1	82498946	missense	unknown
R2122:Col4a4	UTSW	1	82456871	missense	unknown
R2132:Col4a4	UTSW	1	82497860	missense	unknown
R2396:Col4a4	UTSW	1	82507072	missense	unknown
R2418:Col4a4	UTSW	1	82532936	missense	unknown
R2679:Col4a4	UTSW	1	82529611	missense	unknown
R3085:Col4a4	UTSW	1	82529564	critical splice donor site	probably null
R3437:Col4a4	UTSW	1	82497168	missense	unknown
R3697:Col4a4	UTSW	1	82541237	missense	unknown
R3730:Col4a4	UTSW	1	82455751	splice site	probably null
R3752:Col4a4	UTSW	1	82480494	missense	probably damaging	0.97
R4085:Col4a4	UTSW	1	82471188	critical splice donor site	probably null
R4087:Col4a4	UTSW	1	82523922	missense	unknown
R4088:Col4a4	UTSW	1	82523922	missense	unknown
R4090:Col4a4	UTSW	1	82523922	missense	unknown
R4213:Col4a4	UTSW	1	82453144	missense	unknown
R4422:Col4a4	UTSW	1	82489838	missense	unknown
R4596:Col4a4	UTSW	1	82471219	missense	unknown
R4755:Col4a4	UTSW	1	82541174	missense	unknown
R4757:Col4a4	UTSW	1	82528466	missense	unknown
R4793:Col4a4	UTSW	1	82539099	missense	unknown
R4812:Col4a4	UTSW	1	82462153	missense	unknown
R4833:Col4a4	UTSW	1	82529602	missense	unknown
R5259:Col4a4	UTSW	1	82453893	missense	unknown
R5264:Col4a4	UTSW	1	82493591	missense	unknown
R5265:Col4a4	UTSW	1	82493591	missense	unknown
R5281:Col4a4	UTSW	1	82493591	missense	unknown
R5283:Col4a4	UTSW	1	82493591	missense	unknown
R5284:Col4a4	UTSW	1	82493591	missense	unknown
R5387:Col4a4	UTSW	1	82493591	missense	unknown
R5388:Col4a4	UTSW	1	82493591	missense	unknown
R5534:Col4a4	UTSW	1	82487517	missense	unknown
R5666:Col4a4	UTSW	1	82485579	critical splice donor site	probably null
R5670:Col4a4	UTSW	1	82485579	critical splice donor site	probably null
R5943:Col4a4	UTSW	1	82525016	missense	unknown
R5996:Col4a4	UTSW	1	82455728	missense	unknown
R5999:Col4a4	UTSW	1	82492619	missense	unknown
R6112:Col4a4	UTSW	1	82453883	missense	unknown
R6192:Col4a4	UTSW	1	82484430	missense	probably damaging	1.00
R6237:Col4a4	UTSW	1	82507031	missense	unknown
R6419:Col4a4	UTSW	1	82466486	critical splice donor site	probably null
R6458:Col4a4	UTSW	1	82455825	missense	unknown
R6460:Col4a4	UTSW	1	82466532	missense	unknown
R6481:Col4a4	UTSW	1	82453778	missense	unknown
R6522:Col4a4	UTSW	1	82487583	missense	unknown
R7000:Col4a4	UTSW	1	82497330	missense	unknown
R7015:Col4a4	UTSW	1	82506950	missense	unknown
R7055:Col4a4	UTSW	1	82519036	missense	unknown
R7288:Col4a4	UTSW	1	82492463	missense	unknown
R7293:Col4a4	UTSW	1	82523943	missense	unknown
R7300:Col4a4	UTSW	1	82486640	missense	unknown
R7458:Col4a4	UTSW	1	82498948	missense	unknown
R7520:Col4a4	UTSW	1	82507087	nonsense	probably null
R7727:Col4a4	UTSW	1	82528793	missense	unknown
R7803:Col4a4	UTSW	1	82489698	critical splice donor site	probably null
R7953:Col4a4	UTSW	1	82453968	missense	unknown
R7959:Col4a4	UTSW	1	82507059	missense	unknown
R7982:Col4a4	UTSW	1	82571441	start gained	probably benign
R8000:Col4a4	UTSW	1	82541297	missense	unknown
R8057:Col4a4	UTSW	1	82523870	missense	unknown
R8126:Col4a4	UTSW	1	82453286	missense	unknown
R8406:Col4a4	UTSW	1	82523890	missense	unknown
X0020:Col4a4	UTSW	1	82539952	critical splice donor site	probably null
Z1088:Col4a4	UTSW	1	82453196	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATTCAAGGGCAGGAGACTCAC -3'
(R):5'- AGAATGATGGAGGCTGGTCC -3'

Sequencing Primer
(F):5'- AGAGACTCCTCCATGTCCGTG -3'
(R):5'- TGGTCCACAGATCAGGGAG -3'

Posted On

2016-09-01