Incidental Mutation 'R5435:Rbbp5'
ID428241
Institutional Source Beutler Lab
Gene Symbol Rbbp5
Ensembl Gene ENSMUSG00000026439
Gene Nameretinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms4933411J24Rik
MMRRC Submission 043000-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5435 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132477365-132505659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132494275 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 304 (H304Q)
Ref Sequence ENSEMBL: ENSMUSP00000141003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000187505] [ENSMUST00000188575] [ENSMUST00000189786] [ENSMUST00000190825] [ENSMUST00000190997]
Predicted Effect probably damaging
Transcript: ENSMUST00000027700
AA Change: H177Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439
AA Change: H177Q

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187505
AA Change: H177Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439
AA Change: H177Q

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188575
SMART Domains Protein: ENSMUSP00000140344
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 14 55 9e-9 BLAST
SCOP:d1gxra_ 34 87 8e-8 SMART
Blast:WD40 58 107 8e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189786
SMART Domains Protein: ENSMUSP00000140790
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 1 27 1.2e0 SMART
WD40 30 69 4.6e-9 SMART
Blast:WD40 72 149 2e-32 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000190825
AA Change: H304Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439
AA Change: H304Q

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190997
AA Change: H304Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439
AA Change: H304Q

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Meta Mutation Damage Score 0.9138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. The encoded protein binds directly to retinoblastoma protein, which regulates cell proliferation. It interacts preferentially with the underphosphorylated retinoblastoma protein via the E1A-binding pocket B. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,741,250 probably benign Het
3425401B19Rik A G 14: 32,661,456 F851L probably benign Het
Abca17 C T 17: 24,267,614 V1480I possibly damaging Het
Acsbg1 G T 9: 54,615,869 Y491* probably null Het
Acsf3 T A 8: 122,780,281 N104K probably damaging Het
Adam23 T C 1: 63,546,453 Y400H possibly damaging Het
Adgra3 G A 5: 49,990,126 T524M probably damaging Het
Aff1 G A 5: 103,754,332 probably benign Het
Anxa9 T C 3: 95,297,250 Y321C probably damaging Het
Ap1g1 T A 8: 109,838,920 Y329N probably damaging Het
Aph1c A T 9: 66,834,501 I33N possibly damaging Het
B3galnt2 A G 13: 13,996,990 E491G probably benign Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
Ccar2 A G 14: 70,139,327 L856P probably damaging Het
Ccdc107 A T 4: 43,493,519 D30V probably damaging Het
Ccdc116 G T 16: 17,142,762 H64N probably benign Het
Ccl12 T C 11: 82,103,175 I86T possibly damaging Het
Col2a1 T C 15: 98,000,510 probably benign Het
Col4a4 T A 1: 82,454,007 I1519F unknown Het
Ddx19b T C 8: 111,008,826 Q416R possibly damaging Het
Dnah6 T A 6: 73,060,138 M3374L probably benign Het
Dnajc6 A T 4: 101,606,610 I119F probably damaging Het
Ensa C A 3: 95,622,458 probably benign Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxf1 G A 8: 121,084,492 G32S probably damaging Het
Gls2 G A 10: 128,195,126 probably benign Het
Gm13599 T A 2: 67,396,152 noncoding transcript Het
Gmnn A G 13: 24,752,101 S197P probably benign Het
Guf1 A T 5: 69,563,169 H324L probably benign Het
H2-Q6 A G 17: 35,425,685 D150G probably damaging Het
Herc3 T A 6: 58,855,806 L152Q probably damaging Het
Hnrnpul2 T G 19: 8,820,318 S13A probably benign Het
Ighv5-4 A G 12: 113,597,663 F46L probably benign Het
Kank1 T G 19: 25,411,143 S727A probably benign Het
Kcnma1 A T 14: 23,528,404 Y201* probably null Het
Lyst A T 13: 13,777,064 H3750L possibly damaging Het
Mettl25 A G 10: 105,779,586 probably null Het
Mpdz A G 4: 81,283,487 probably benign Het
Myh9 C T 15: 77,769,609 V1280I probably benign Het
Neto1 A T 18: 86,398,263 T32S probably benign Het
Nol7 C A 13: 43,401,372 H187Q possibly damaging Het
Olfr992 T A 2: 85,400,470 N21I probably benign Het
Pcdha8 A G 18: 36,993,599 D378G probably damaging Het
Peak1 A G 9: 56,206,486 S694P probably damaging Het
Pih1d1 T A 7: 45,156,272 probably null Het
Pik3c2g T G 6: 139,715,855 probably null Het
Prkar2a A G 9: 108,740,483 R247G probably damaging Het
Psg26 A G 7: 18,478,473 I319T possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa3 T C 8: 13,631,811 E46G possibly damaging Het
Scn1a T A 2: 66,273,534 E1783V probably damaging Het
Stag1 A G 9: 100,953,550 N151S probably benign Het
Tbc1d32 C A 10: 56,040,150 A1191S probably damaging Het
Tchh C A 3: 93,443,672 R140S possibly damaging Het
Trank1 A G 9: 111,391,890 Y2565C probably benign Het
Ttn A T 2: 76,914,358 V5449D probably damaging Het
Tubgcp2 G A 7: 139,996,072 P893S possibly damaging Het
Wdfy4 A G 14: 33,020,311 F2325S probably damaging Het
Wdr35 A G 12: 8,989,951 D352G probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Ypel3 A G 7: 126,775,788 probably benign Het
Zan T A 5: 137,403,762 T4023S unknown Het
Zfp735 T A 11: 73,712,113 C628S possibly damaging Het
Other mutations in Rbbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Rbbp5 APN 1 132489706 missense probably damaging 1.00
IGL01373:Rbbp5 APN 1 132492601 missense probably benign 0.07
IGL01577:Rbbp5 APN 1 132492655 missense possibly damaging 0.68
IGL01728:Rbbp5 APN 1 132498080 missense probably benign
R0097:Rbbp5 UTSW 1 132490489 missense possibly damaging 0.81
R0420:Rbbp5 UTSW 1 132493844 missense possibly damaging 0.88
R1540:Rbbp5 UTSW 1 132494282 nonsense probably null
R1965:Rbbp5 UTSW 1 132494297 missense probably damaging 1.00
R2419:Rbbp5 UTSW 1 132493826 missense possibly damaging 0.95
R2924:Rbbp5 UTSW 1 132492663 critical splice donor site probably null
R3810:Rbbp5 UTSW 1 132492587 missense probably damaging 0.98
R3811:Rbbp5 UTSW 1 132492587 missense probably damaging 0.98
R4234:Rbbp5 UTSW 1 132484758 missense probably benign 0.08
R5024:Rbbp5 UTSW 1 132490488 missense possibly damaging 0.65
R5166:Rbbp5 UTSW 1 132490565 missense possibly damaging 0.60
R6018:Rbbp5 UTSW 1 132494340 missense probably damaging 1.00
R6172:Rbbp5 UTSW 1 132496816 missense possibly damaging 0.89
R7500:Rbbp5 UTSW 1 132494141 missense probably benign 0.35
X0019:Rbbp5 UTSW 1 132489698 missense probably damaging 1.00
X0025:Rbbp5 UTSW 1 132489658 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAGCATTGGCAACCTGG -3'
(R):5'- TGGAAACCAGCTCTGAACTAAGG -3'

Sequencing Primer
(F):5'- CCTGGTGAAGATCTTACATGGGACC -3'
(R):5'- TTAGCCTACAAGGATCAGATGC -3'
Posted On2016-09-01