Incidental Mutation 'R5435:Olfr992'
ID428245
Institutional Source Beutler Lab
Gene Symbol Olfr992
Ensembl Gene ENSMUSG00000075221
Gene Nameolfactory receptor 992
SynonymsMOR203-1, GA_x6K02T2Q125-46877170-46876241
MMRRC Submission 043000-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5435 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85398824-85409469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85400470 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 21 (N21I)
Ref Sequence ENSEMBL: ENSMUSP00000149132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099927] [ENSMUST00000213749] [ENSMUST00000214895] [ENSMUST00000215617]
Predicted Effect probably benign
Transcript: ENSMUST00000099927
AA Change: N21I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097511
Gene: ENSMUSG00000075221
AA Change: N21I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 285 3.3e-6 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213749
AA Change: N21I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000214895
AA Change: N21I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215617
AA Change: N21I

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215967
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,741,250 probably benign Het
3425401B19Rik A G 14: 32,661,456 F851L probably benign Het
Abca17 C T 17: 24,267,614 V1480I possibly damaging Het
Acsbg1 G T 9: 54,615,869 Y491* probably null Het
Acsf3 T A 8: 122,780,281 N104K probably damaging Het
Adam23 T C 1: 63,546,453 Y400H possibly damaging Het
Adgra3 G A 5: 49,990,126 T524M probably damaging Het
Aff1 G A 5: 103,754,332 probably benign Het
Anxa9 T C 3: 95,297,250 Y321C probably damaging Het
Ap1g1 T A 8: 109,838,920 Y329N probably damaging Het
Aph1c A T 9: 66,834,501 I33N possibly damaging Het
B3galnt2 A G 13: 13,996,990 E491G probably benign Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
Ccar2 A G 14: 70,139,327 L856P probably damaging Het
Ccdc107 A T 4: 43,493,519 D30V probably damaging Het
Ccdc116 G T 16: 17,142,762 H64N probably benign Het
Ccl12 T C 11: 82,103,175 I86T possibly damaging Het
Col2a1 T C 15: 98,000,510 probably benign Het
Col4a4 T A 1: 82,454,007 I1519F unknown Het
Ddx19b T C 8: 111,008,826 Q416R possibly damaging Het
Dnah6 T A 6: 73,060,138 M3374L probably benign Het
Dnajc6 A T 4: 101,606,610 I119F probably damaging Het
Ensa C A 3: 95,622,458 probably benign Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxf1 G A 8: 121,084,492 G32S probably damaging Het
Gls2 G A 10: 128,195,126 probably benign Het
Gm13599 T A 2: 67,396,152 noncoding transcript Het
Gmnn A G 13: 24,752,101 S197P probably benign Het
Guf1 A T 5: 69,563,169 H324L probably benign Het
H2-Q6 A G 17: 35,425,685 D150G probably damaging Het
Herc3 T A 6: 58,855,806 L152Q probably damaging Het
Hnrnpul2 T G 19: 8,820,318 S13A probably benign Het
Ighv5-4 A G 12: 113,597,663 F46L probably benign Het
Kank1 T G 19: 25,411,143 S727A probably benign Het
Kcnma1 A T 14: 23,528,404 Y201* probably null Het
Lyst A T 13: 13,777,064 H3750L possibly damaging Het
Mettl25 A G 10: 105,779,586 probably null Het
Mpdz A G 4: 81,283,487 probably benign Het
Myh9 C T 15: 77,769,609 V1280I probably benign Het
Neto1 A T 18: 86,398,263 T32S probably benign Het
Nol7 C A 13: 43,401,372 H187Q possibly damaging Het
Pcdha8 A G 18: 36,993,599 D378G probably damaging Het
Peak1 A G 9: 56,206,486 S694P probably damaging Het
Pih1d1 T A 7: 45,156,272 probably null Het
Pik3c2g T G 6: 139,715,855 probably null Het
Prkar2a A G 9: 108,740,483 R247G probably damaging Het
Psg26 A G 7: 18,478,473 I319T possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa3 T C 8: 13,631,811 E46G possibly damaging Het
Rbbp5 T A 1: 132,494,275 H304Q probably damaging Het
Scn1a T A 2: 66,273,534 E1783V probably damaging Het
Stag1 A G 9: 100,953,550 N151S probably benign Het
Tbc1d32 C A 10: 56,040,150 A1191S probably damaging Het
Tchh C A 3: 93,443,672 R140S possibly damaging Het
Trank1 A G 9: 111,391,890 Y2565C probably benign Het
Ttn A T 2: 76,914,358 V5449D probably damaging Het
Tubgcp2 G A 7: 139,996,072 P893S possibly damaging Het
Wdfy4 A G 14: 33,020,311 F2325S probably damaging Het
Wdr35 A G 12: 8,989,951 D352G probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Ypel3 A G 7: 126,775,788 probably benign Het
Zan T A 5: 137,403,762 T4023S unknown Het
Zfp735 T A 11: 73,712,113 C628S possibly damaging Het
Other mutations in Olfr992
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr992 APN 2 85400171 missense probably damaging 1.00
IGL02538:Olfr992 APN 2 85400303 missense probably damaging 1.00
IGL02550:Olfr992 APN 2 85399822 missense probably damaging 0.99
R0128:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0130:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0345:Olfr992 UTSW 2 85400341 missense possibly damaging 0.60
R0413:Olfr992 UTSW 2 85399675 missense probably damaging 1.00
R0535:Olfr992 UTSW 2 85400095 missense possibly damaging 0.71
R1243:Olfr992 UTSW 2 85400273 missense probably benign
R1255:Olfr992 UTSW 2 85400303 missense probably damaging 1.00
R1293:Olfr992 UTSW 2 85400353 splice site probably null
R1840:Olfr992 UTSW 2 85400168 missense probably benign 0.42
R1847:Olfr992 UTSW 2 85400441 missense probably damaging 0.99
R2300:Olfr992 UTSW 2 85400132 missense probably benign
R4574:Olfr992 UTSW 2 85400026 missense probably damaging 1.00
R4872:Olfr992 UTSW 2 85400428 missense probably damaging 1.00
R6846:Olfr992 UTSW 2 85400517 missense probably damaging 1.00
R7075:Olfr992 UTSW 2 85400200 missense probably damaging 1.00
R7253:Olfr992 UTSW 2 85399639 missense probably benign 0.00
R7454:Olfr992 UTSW 2 85399611 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATTTTGCAGTGTCCTGGG -3'
(R):5'- CATCTGTACACATATGCCCAATTTCAC -3'

Sequencing Primer
(F):5'- TCCTGGGAGTGATGGCAGAG -3'
(R):5'- TGCCCAATTTCACATAAATGTACAC -3'
Posted On2016-09-01