Incidental Mutation 'R5435:Peak1'
ID428268
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Namepseudopodium-enriched atypical kinase 1
SynonymsC230081A13Rik, NKF3 kinase family member, 1110049L02Rik
MMRRC Submission 043000-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R5435 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56201126-56418067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56206486 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 694 (S694P)
Ref Sequence ENSEMBL: ENSMUSP00000139985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000188142]
Predicted Effect probably damaging
Transcript: ENSMUST00000061552
AA Change: S1724P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: S1724P

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188142
AA Change: S694P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139985
Gene: ENSMUSG00000074305
AA Change: S694P

DomainStartEndE-ValueType
STYKc 288 622 5.5e-4 SMART
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,741,250 probably benign Het
3425401B19Rik A G 14: 32,661,456 F851L probably benign Het
Abca17 C T 17: 24,267,614 V1480I possibly damaging Het
Acsbg1 G T 9: 54,615,869 Y491* probably null Het
Acsf3 T A 8: 122,780,281 N104K probably damaging Het
Adam23 T C 1: 63,546,453 Y400H possibly damaging Het
Adgra3 G A 5: 49,990,126 T524M probably damaging Het
Aff1 G A 5: 103,754,332 probably benign Het
Anxa9 T C 3: 95,297,250 Y321C probably damaging Het
Ap1g1 T A 8: 109,838,920 Y329N probably damaging Het
Aph1c A T 9: 66,834,501 I33N possibly damaging Het
B3galnt2 A G 13: 13,996,990 E491G probably benign Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
Ccar2 A G 14: 70,139,327 L856P probably damaging Het
Ccdc107 A T 4: 43,493,519 D30V probably damaging Het
Ccdc116 G T 16: 17,142,762 H64N probably benign Het
Ccl12 T C 11: 82,103,175 I86T possibly damaging Het
Col2a1 T C 15: 98,000,510 probably benign Het
Col4a4 T A 1: 82,454,007 I1519F unknown Het
Ddx19b T C 8: 111,008,826 Q416R possibly damaging Het
Dnah6 T A 6: 73,060,138 M3374L probably benign Het
Dnajc6 A T 4: 101,606,610 I119F probably damaging Het
Ensa C A 3: 95,622,458 probably benign Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxf1 G A 8: 121,084,492 G32S probably damaging Het
Gls2 G A 10: 128,195,126 probably benign Het
Gm13599 T A 2: 67,396,152 noncoding transcript Het
Gmnn A G 13: 24,752,101 S197P probably benign Het
Guf1 A T 5: 69,563,169 H324L probably benign Het
H2-Q6 A G 17: 35,425,685 D150G probably damaging Het
Herc3 T A 6: 58,855,806 L152Q probably damaging Het
Hnrnpul2 T G 19: 8,820,318 S13A probably benign Het
Ighv5-4 A G 12: 113,597,663 F46L probably benign Het
Kank1 T G 19: 25,411,143 S727A probably benign Het
Kcnma1 A T 14: 23,528,404 Y201* probably null Het
Lyst A T 13: 13,777,064 H3750L possibly damaging Het
Mettl25 A G 10: 105,779,586 probably null Het
Mpdz A G 4: 81,283,487 probably benign Het
Myh9 C T 15: 77,769,609 V1280I probably benign Het
Neto1 A T 18: 86,398,263 T32S probably benign Het
Nol7 C A 13: 43,401,372 H187Q possibly damaging Het
Olfr992 T A 2: 85,400,470 N21I probably benign Het
Pcdha8 A G 18: 36,993,599 D378G probably damaging Het
Pih1d1 T A 7: 45,156,272 probably null Het
Pik3c2g T G 6: 139,715,855 probably null Het
Prkar2a A G 9: 108,740,483 R247G probably damaging Het
Psg26 A G 7: 18,478,473 I319T possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa3 T C 8: 13,631,811 E46G possibly damaging Het
Rbbp5 T A 1: 132,494,275 H304Q probably damaging Het
Scn1a T A 2: 66,273,534 E1783V probably damaging Het
Stag1 A G 9: 100,953,550 N151S probably benign Het
Tbc1d32 C A 10: 56,040,150 A1191S probably damaging Het
Tchh C A 3: 93,443,672 R140S possibly damaging Het
Trank1 A G 9: 111,391,890 Y2565C probably benign Het
Ttn A T 2: 76,914,358 V5449D probably damaging Het
Tubgcp2 G A 7: 139,996,072 P893S possibly damaging Het
Wdfy4 A G 14: 33,020,311 F2325S probably damaging Het
Wdr35 A G 12: 8,989,951 D352G probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Ypel3 A G 7: 126,775,788 probably benign Het
Zan T A 5: 137,403,762 T4023S unknown Het
Zfp735 T A 11: 73,712,113 C628S possibly damaging Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56227326 missense probably damaging 1.00
IGL00544:Peak1 APN 9 56259978 missense probably damaging 1.00
IGL01141:Peak1 APN 9 56258527 missense probably benign 0.01
IGL01743:Peak1 APN 9 56259202 missense probably damaging 1.00
IGL01781:Peak1 APN 9 56260065 missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56260104 missense probably damaging 1.00
IGL01941:Peak1 APN 9 56258775 missense probably damaging 1.00
IGL02455:Peak1 APN 9 56227473 missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56227206 missense probably damaging 1.00
IGL03247:Peak1 APN 9 56257930 missense probably damaging 1.00
IGL03259:Peak1 APN 9 56259967 missense probably damaging 1.00
R0060:Peak1 UTSW 9 56227823 missense probably damaging 1.00
R0087:Peak1 UTSW 9 56258325 missense probably damaging 1.00
R0480:Peak1 UTSW 9 56258632 missense probably benign 0.00
R0569:Peak1 UTSW 9 56260089 missense probably damaging 1.00
R0605:Peak1 UTSW 9 56227098 splice site probably benign
R0865:Peak1 UTSW 9 56257832 missense probably benign 0.02
R1117:Peak1 UTSW 9 56258418 missense probably benign 0.05
R1922:Peak1 UTSW 9 56206687 missense probably damaging 1.00
R1959:Peak1 UTSW 9 56206789 missense probably damaging 1.00
R2069:Peak1 UTSW 9 56258759 missense probably damaging 1.00
R2083:Peak1 UTSW 9 56258949 missense probably damaging 1.00
R2154:Peak1 UTSW 9 56207212 missense probably damaging 1.00
R2407:Peak1 UTSW 9 56259226 missense probably damaging 1.00
R3832:Peak1 UTSW 9 56258383 missense probably benign
R3938:Peak1 UTSW 9 56260365 missense probably benign 0.01
R3964:Peak1 UTSW 9 56259979 missense probably damaging 1.00
R4192:Peak1 UTSW 9 56258741 missense probably damaging 1.00
R4381:Peak1 UTSW 9 56258427 missense probably benign 0.34
R4869:Peak1 UTSW 9 56227592 missense probably benign 0.06
R4994:Peak1 UTSW 9 56241276 missense possibly damaging 0.65
R5062:Peak1 UTSW 9 56260289 missense probably damaging 1.00
R5632:Peak1 UTSW 9 56257774 missense probably damaging 1.00
R5643:Peak1 UTSW 9 56258755 missense probably damaging 0.99
R5880:Peak1 UTSW 9 56207610 missense probably damaging 1.00
R5898:Peak1 UTSW 9 56207338 missense probably benign 0.19
R5986:Peak1 UTSW 9 56259442 missense probably benign 0.00
R6109:Peak1 UTSW 9 56259283 missense probably benign 0.01
R6284:Peak1 UTSW 9 56260296 missense probably benign 0.10
R6347:Peak1 UTSW 9 56258211 missense probably benign 0.00
R6374:Peak1 UTSW 9 56257666 missense probably damaging 1.00
R6471:Peak1 UTSW 9 56258259 missense probably damaging 1.00
R6717:Peak1 UTSW 9 56207239 missense probably benign 0.00
R7033:Peak1 UTSW 9 56259707 missense probably damaging 1.00
R7039:Peak1 UTSW 9 56257809 missense probably benign 0.01
R7100:Peak1 UTSW 9 56259393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAATGGAGCCCATGTC -3'
(R):5'- ATCCTCCAATGTCTGCTCTGGG -3'

Sequencing Primer
(F):5'- AATGGAGCCCATGTCCCTGG -3'
(R):5'- GGCCCCCGAGAAGATCTCTTTC -3'
Posted On2016-09-01