Mutagenetix > Incidental Mutations

Incidental Mutation 'R5435:Kank1'

428301

Institutional Source

Beutler Lab

Gene Symbol

Kank1

Ensembl Gene

ENSMUSG00000032702

Gene Name

KN motif and ankyrin repeat domains 1

Synonyms

D330024H06Rik, Ankrd15, A930031B09Rik

MMRRC Submission

043000-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5435 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25236975-25434496 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 25411143 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 727 (S727A)

Ref Sequence

ENSEMBL: ENSMUSP00000116660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]

Predicted Effect

probably benign
Transcript: ENSMUST00000049400
AA Change: S699A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: S699A

Domain	Start	End	E-Value	Type
Pfam:KN_motif	30	68	3.3e-24	PFAM
low complexity region	88	105	N/A	INTRINSIC
low complexity region	138	148	N/A	INTRINSIC
coiled coil region	286	314	N/A	INTRINSIC
low complexity region	350	358	N/A	INTRINSIC
coiled coil region	362	395	N/A	INTRINSIC
coiled coil region	451	494	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Blast:ANK	963	993	7e-10	BLAST
low complexity region	1010	1030	N/A	INTRINSIC
low complexity region	1074	1095	N/A	INTRINSIC
ANK	1169	1199	3.71e-4	SMART
ANK	1203	1236	2.27e1	SMART
ANK	1241	1270	1.33e-5	SMART
ANK	1274	1306	5.84e-2	SMART
ANK	1308	1336	4.86e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137260

Predicted Effect

probably benign
Transcript: ENSMUST00000146647
AA Change: S727A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: S727A

Domain	Start	End	E-Value	Type
Pfam:KN_motif	58	96	2e-25	PFAM
low complexity region	116	133	N/A	INTRINSIC
low complexity region	166	176	N/A	INTRINSIC
coiled coil region	314	342	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
coiled coil region	390	423	N/A	INTRINSIC
internal_repeat_1	430	479	3.72e-5	PROSPERO
low complexity region	569	584	N/A	INTRINSIC
internal_repeat_1	587	636	3.72e-5	PROSPERO
low complexity region	645	657	N/A	INTRINSIC
Blast:ANK	991	1021	4e-10	BLAST
low complexity region	1038	1058	N/A	INTRINSIC
low complexity region	1102	1123	N/A	INTRINSIC

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,741,250		probably benign	Het
3425401B19Rik	A	G	14: 32,661,456	F851L	probably benign	Het
Abca17	C	T	17: 24,267,614	V1480I	possibly damaging	Het
Acsbg1	G	T	9: 54,615,869	Y491*	probably null	Het
Acsf3	T	A	8: 122,780,281	N104K	probably damaging	Het
Adam23	T	C	1: 63,546,453	Y400H	possibly damaging	Het
Adgra3	G	A	5: 49,990,126	T524M	probably damaging	Het
Aff1	G	A	5: 103,754,332		probably benign	Het
Anxa9	T	C	3: 95,297,250	Y321C	probably damaging	Het
Ap1g1	T	A	8: 109,838,920	Y329N	probably damaging	Het
Aph1c	A	T	9: 66,834,501	I33N	possibly damaging	Het
B3galnt2	A	G	13: 13,996,990	E491G	probably benign	Het
Bdh1	C	T	16: 31,456,657	R235C	probably damaging	Het
Ccar2	A	G	14: 70,139,327	L856P	probably damaging	Het
Ccdc107	A	T	4: 43,493,519	D30V	probably damaging	Het
Ccdc116	G	T	16: 17,142,762	H64N	probably benign	Het
Ccl12	T	C	11: 82,103,175	I86T	possibly damaging	Het
Col2a1	T	C	15: 98,000,510		probably benign	Het
Col4a4	T	A	1: 82,454,007	I1519F	unknown	Het
Ddx19b	T	C	8: 111,008,826	Q416R	possibly damaging	Het
Dnah6	T	A	6: 73,060,138	M3374L	probably benign	Het
Dnajc6	A	T	4: 101,606,610	I119F	probably damaging	Het
Ensa	C	A	3: 95,622,458		probably benign	Het
Fbxo4	C	T	15: 3,965,792	V357I	possibly damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Foxf1	G	A	8: 121,084,492	G32S	probably damaging	Het
Gls2	G	A	10: 128,195,126		probably benign	Het
Gm13599	T	A	2: 67,396,152		noncoding transcript	Het
Gmnn	A	G	13: 24,752,101	S197P	probably benign	Het
Guf1	A	T	5: 69,563,169	H324L	probably benign	Het
H2-Q6	A	G	17: 35,425,685	D150G	probably damaging	Het
Herc3	T	A	6: 58,855,806	L152Q	probably damaging	Het
Hnrnpul2	T	G	19: 8,820,318	S13A	probably benign	Het
Ighv5-4	A	G	12: 113,597,663	F46L	probably benign	Het
Kcnma1	A	T	14: 23,528,404	Y201*	probably null	Het
Lyst	A	T	13: 13,777,064	H3750L	possibly damaging	Het
Mettl25	A	G	10: 105,779,586		probably null	Het
Mpdz	A	G	4: 81,283,487		probably benign	Het
Myh9	C	T	15: 77,769,609	V1280I	probably benign	Het
Neto1	A	T	18: 86,398,263	T32S	probably benign	Het
Nol7	C	A	13: 43,401,372	H187Q	possibly damaging	Het
Olfr992	T	A	2: 85,400,470	N21I	probably benign	Het
Pcdha8	A	G	18: 36,993,599	D378G	probably damaging	Het
Peak1	A	G	9: 56,206,486	S694P	probably damaging	Het
Pih1d1	T	A	7: 45,156,272		probably null	Het
Pik3c2g	T	G	6: 139,715,855		probably null	Het
Prkar2a	A	G	9: 108,740,483	R247G	probably damaging	Het
Psg26	A	G	7: 18,478,473	I319T	possibly damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa3	T	C	8: 13,631,811	E46G	possibly damaging	Het
Rbbp5	T	A	1: 132,494,275	H304Q	probably damaging	Het
Scn1a	T	A	2: 66,273,534	E1783V	probably damaging	Het
Stag1	A	G	9: 100,953,550	N151S	probably benign	Het
Tbc1d32	C	A	10: 56,040,150	A1191S	probably damaging	Het
Tchh	C	A	3: 93,443,672	R140S	possibly damaging	Het
Trank1	A	G	9: 111,391,890	Y2565C	probably benign	Het
Ttn	A	T	2: 76,914,358	V5449D	probably damaging	Het
Tubgcp2	G	A	7: 139,996,072	P893S	possibly damaging	Het
Wdfy4	A	G	14: 33,020,311	F2325S	probably damaging	Het
Wdr35	A	G	12: 8,989,951	D352G	probably benign	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Ypel3	A	G	7: 126,775,788		probably benign	Het
Zan	T	A	5: 137,403,762	T4023S	unknown	Het
Zfp735	T	A	11: 73,712,113	C628S	possibly damaging	Het

Other mutations in Kank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Kank1	APN	19	25411758	missense	probably benign
IGL00435:Kank1	APN	19	25430236	missense	probably benign	0.41
IGL01105:Kank1	APN	19	25424316	missense	possibly damaging	0.80
IGL01974:Kank1	APN	19	25410232	missense	possibly damaging	0.87
IGL02031:Kank1	APN	19	25410702	missense	probably benign	0.01
IGL02125:Kank1	APN	19	25410703	missense	possibly damaging	0.90
IGL02152:Kank1	APN	19	25428172	missense	possibly damaging	0.51
IGL02211:Kank1	APN	19	25430338	missense	probably damaging	1.00
IGL02440:Kank1	APN	19	25432908	missense	probably damaging	1.00
IGL02448:Kank1	APN	19	25411375	missense	probably damaging	1.00
IGL02671:Kank1	APN	19	25428095	missense	probably damaging	1.00
IGL03102:Kank1	APN	19	25425918	missense	probably damaging	1.00
IGL03259:Kank1	APN	19	25430341	missense	probably damaging	1.00
IGL02802:Kank1	UTSW	19	25411599	missense	probably damaging	1.00
R0107:Kank1	UTSW	19	25430366	unclassified	probably benign
R0190:Kank1	UTSW	19	25409283	missense	probably benign	0.00
R0330:Kank1	UTSW	19	25424313	missense	probably benign	0.00
R0368:Kank1	UTSW	19	25410603	nonsense	probably null
R0399:Kank1	UTSW	19	25411242	missense	probably benign	0.00
R0426:Kank1	UTSW	19	25411473	missense	probably damaging	1.00
R0483:Kank1	UTSW	19	25425993	unclassified	probably benign
R1394:Kank1	UTSW	19	25428164	missense	probably damaging	1.00
R1495:Kank1	UTSW	19	25410349	missense	probably damaging	0.98
R1681:Kank1	UTSW	19	25410304	missense	possibly damaging	0.89
R1698:Kank1	UTSW	19	25411317	missense	probably benign	0.11
R1830:Kank1	UTSW	19	25411032	missense	probably benign	0.00
R1866:Kank1	UTSW	19	25411449	missense	probably benign	0.04
R2138:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2139:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2420:Kank1	UTSW	19	25410457	missense	probably damaging	1.00
R3153:Kank1	UTSW	19	25410688	missense	possibly damaging	0.89
R4164:Kank1	UTSW	19	25411072	missense	probably benign	0.10
R4670:Kank1	UTSW	19	25410580	missense	probably benign	0.00
R4685:Kank1	UTSW	19	25410034	missense	possibly damaging	0.66
R4843:Kank1	UTSW	19	25431007	missense	probably damaging	1.00
R4981:Kank1	UTSW	19	25411395	missense	probably benign	0.19
R5189:Kank1	UTSW	19	25424181	missense	probably damaging	1.00
R5280:Kank1	UTSW	19	25411305	missense	probably benign	0.01
R5330:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5331:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5500:Kank1	UTSW	19	25424332	missense	possibly damaging	0.46
R5894:Kank1	UTSW	19	25424200	missense	probably damaging	1.00
R6087:Kank1	UTSW	19	25409724	missense	probably benign	0.41
R6357:Kank1	UTSW	19	25411353	missense	probably benign	0.36
R6490:Kank1	UTSW	19	25410085	missense	probably damaging	1.00
R6504:Kank1	UTSW	19	25428154	missense	probably damaging	1.00
R6942:Kank1	UTSW	19	25424173	missense	possibly damaging	0.88
R7037:Kank1	UTSW	19	25430341	missense	probably damaging	1.00
R7405:Kank1	UTSW	19	25410319	nonsense	probably null
R7486:Kank1	UTSW	19	25410829	missense	probably damaging	0.99
R7602:Kank1	UTSW	19	25422161	missense	probably benign	0.01
R7701:Kank1	UTSW	19	25411765	critical splice donor site	probably null
R7765:Kank1	UTSW	19	25411205	frame shift	probably null
R7766:Kank1	UTSW	19	25411205	frame shift	probably null
R7768:Kank1	UTSW	19	25411205	frame shift	probably null
R7919:Kank1	UTSW	19	25431075	missense	probably damaging	1.00
R7974:Kank1	UTSW	19	25424220	missense	probably damaging	1.00
R7978:Kank1	UTSW	19	25411205	frame shift	probably null
R8017:Kank1	UTSW	19	25411204	frame shift	probably null
R8017:Kank1	UTSW	19	25411205	frame shift	probably null
R8020:Kank1	UTSW	19	25411205	frame shift	probably null
R8150:Kank1	UTSW	19	25410799	missense	possibly damaging	0.88
R8322:Kank1	UTSW	19	25378478	start gained	probably benign
R8374:Kank1	UTSW	19	25411641	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGAACCTCAAAGACGTGCG -3'
(R):5'- AGCACATGGCCTGTCAAACTC -3'

Sequencing Primer
(F):5'- CCATCGGCTGTGGAGATTG -3'
(R):5'- TGGCCTGTCAAACTCAGAATTGC -3'

Posted On

2016-09-01