Incidental Mutation 'R5436:Sec31a'
ID428330
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
MMRRC Submission 043001-MU
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R5436 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100363839 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 330 (A330S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886]
Predicted Effect probably damaging
Transcript: ENSMUST00000094578
AA Change: A1144S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: A1144S

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182002
Predicted Effect probably benign
Transcript: ENSMUST00000182433
AA Change: A177S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182664
Predicted Effect probably damaging
Transcript: ENSMUST00000182812
AA Change: A330S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000182886
AA Change: A1105S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: A1105S

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182988
AA Change: A847S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.1313 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,764,499 K415N probably benign Het
4930449A18Rik T C 3: 59,846,693 noncoding transcript Het
Abca9 G A 11: 110,134,236 L994F probably damaging Het
Abl2 A T 1: 156,629,880 S239C probably damaging Het
Acsl5 T A 19: 55,279,565 probably null Het
Aff1 C T 5: 103,783,870 T126I probably damaging Het
Amtn T C 5: 88,381,626 L107P probably damaging Het
Ankrd45 A G 1: 161,159,112 probably benign Het
Arl6ip5 G A 6: 97,210,926 V36I probably damaging Het
Ascc3 T A 10: 50,658,983 D657E probably damaging Het
Ascl1 T A 10: 87,492,946 Q48L unknown Het
Asic4 T A 1: 75,451,319 V163E probably benign Het
Atm A T 9: 53,459,804 M2245K probably benign Het
Barx2 T G 9: 31,912,989 T35P probably damaging Het
BC027072 A T 17: 71,750,842 S613R probably damaging Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
C8b T A 4: 104,800,349 Y404* probably null Het
Car5a A G 8: 121,917,242 probably benign Het
Ccdc13 T C 9: 121,799,043 I169M probably benign Het
Cd163 A T 6: 124,327,964 D1100V probably benign Het
Cntfr T C 4: 41,663,322 N162D probably damaging Het
Cops3 T G 11: 59,824,345 D289A probably damaging Het
Crbn A T 6: 106,795,900 S42R probably damaging Het
Cth T A 3: 157,894,826 H397L probably benign Het
Dact2 A G 17: 14,195,748 L730P probably damaging Het
Dhx37 C T 5: 125,429,803 G210R probably benign Het
Dnah1 T C 14: 31,316,747 I126V probably benign Het
Dnttip2 T C 3: 122,278,769 I566T probably damaging Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam110b A C 4: 5,799,104 Q174P probably benign Het
Fam149a A T 8: 45,348,471 S457T probably benign Het
Fat3 A C 9: 15,960,514 V3527G probably benign Het
Fat4 A G 3: 38,891,346 M1463V probably benign Het
Gak T A 5: 108,592,352 I566F possibly damaging Het
Gdf10 T A 14: 33,932,256 I240N probably damaging Het
Gprc6a T A 10: 51,626,702 H355L probably benign Het
Gxylt1 T C 15: 93,247,899 K338R probably damaging Het
Hexim2 A T 11: 103,138,269 E49V probably null Het
Hfm1 T C 5: 106,892,772 D709G possibly damaging Het
Ighv1-49 T C 12: 115,055,461 K19R probably damaging Het
Il17a T A 1: 20,733,646 Y88* probably null Het
Iqsec1 A T 6: 90,845,361 probably benign Het
Itih2 T C 2: 10,105,196 D582G probably benign Het
Klc3 T C 7: 19,397,959 probably null Het
Larp4 T A 15: 99,986,114 N78K probably damaging Het
Larp4b A G 13: 9,168,900 D526G possibly damaging Het
Lexm A T 4: 106,610,493 H315Q probably benign Het
Limch1 T C 5: 66,974,566 V133A possibly damaging Het
Lmbr1l G A 15: 98,904,791 R426C probably damaging Het
Lox T A 18: 52,529,103 D76V probably benign Het
Lrrc8d T A 5: 105,812,552 I276N probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
March10 A T 11: 105,402,165 Y139N possibly damaging Het
Mrc1 T G 2: 14,266,515 I410S probably damaging Het
Mrto4 A T 4: 139,347,965 C176S probably damaging Het
Mtch1 G T 17: 29,347,590 D66E probably benign Het
Nbas T G 12: 13,374,811 L1017R probably damaging Het
Nim1k A G 13: 119,727,529 probably benign Het
Nlrp6 T A 7: 140,922,717 Y245* probably null Het
Olfr1264 T A 2: 90,021,665 M134L probably benign Het
Olfr192 C T 16: 59,098,819 V58I unknown Het
Olfr224 T A 11: 58,566,937 H136L probably benign Het
Olfr635 A T 7: 103,979,266 I25F probably benign Het
Olfr740 T G 14: 50,453,727 V225G probably damaging Het
Olfr906 A C 9: 38,488,539 D170A probably benign Het
Pcnx G T 12: 81,860,406 G12V probably damaging Het
Pdzd3 A G 9: 44,248,355 V448A possibly damaging Het
Pkp1 T A 1: 135,918,918 K32M probably damaging Het
Poc5 T C 13: 96,396,813 W150R probably damaging Het
Ppp1r16b T A 2: 158,757,333 probably benign Het
Prune2 T A 19: 17,020,643 M248K probably damaging Het
Rb1 A T 14: 73,213,140 probably null Het
Rhod A G 19: 4,426,587 C169R probably benign Het
Rif1 T C 2: 52,120,971 probably benign Het
Rnpc3 G A 3: 113,624,999 A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,579,931 probably benign Het
Scnn1a A T 6: 125,343,022 D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 T59K probably benign Het
Sgk3 A G 1: 9,881,872 D241G probably damaging Het
Skint6 T G 4: 113,096,591 I459L probably benign Het
Slco1a5 A T 6: 142,254,392 V222E probably damaging Het
Slit3 T A 11: 35,707,911 N1447K probably benign Het
Sorbs2 A G 8: 45,796,001 H628R probably damaging Het
St6galnac2 A G 11: 116,684,527 probably benign Het
Tbc1d31 T C 15: 57,952,871 V667A probably benign Het
Tbx20 A T 9: 24,769,720 Y159N probably damaging Het
Tmprss11b T A 5: 86,662,233 Q296L probably benign Het
Ttc6 T A 12: 57,674,594 probably null Het
Ttn T A 2: 76,870,899 probably benign Het
Tubgcp4 T A 2: 121,188,136 L340H probably damaging Het
Tubgcp4 T A 2: 121,194,182 F613I probably benign Het
Urb1 T C 16: 90,792,762 Y377C probably damaging Het
Utp15 G A 13: 98,260,846 probably null Het
Vstm2b A G 7: 40,901,283 probably null Het
Vwde A T 6: 13,190,628 V488D probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp276 A T 8: 123,265,282 probably benign Het
Zfp318 T A 17: 46,413,049 S1993T possibly damaging Het
Zfp959 T C 17: 55,897,626 L218P probably benign Het
Zxdc A G 6: 90,370,560 D301G probably damaging Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
Discipline UTSW 5 100363878 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 unclassified probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
R8088:Sec31a UTSW 5 100378862 missense
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAATAATGAAGGAGCGCCAC -3'
(R):5'- AAGGCTGTTGGTTCTCTTCAC -3'

Sequencing Primer
(F):5'- CACATGTGTGCAGTGCCTTCAG -3'
(R):5'- GGTTCTCTTCACATAGAATCAGAAC -3'
Posted On2016-09-01