Incidental Mutation 'R5436:Cd163'
ID428342
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission 043001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5436 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124327964 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1100 (D1100V)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect probably benign
Transcript: ENSMUST00000032234
AA Change: D1100V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: D1100V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112541
AA Change: D1100V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: D1100V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203210
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,764,499 K415N probably benign Het
4930449A18Rik T C 3: 59,846,693 noncoding transcript Het
Abca9 G A 11: 110,134,236 L994F probably damaging Het
Abl2 A T 1: 156,629,880 S239C probably damaging Het
Acsl5 T A 19: 55,279,565 probably null Het
Aff1 C T 5: 103,783,870 T126I probably damaging Het
Amtn T C 5: 88,381,626 L107P probably damaging Het
Ankrd45 A G 1: 161,159,112 probably benign Het
Arl6ip5 G A 6: 97,210,926 V36I probably damaging Het
Ascc3 T A 10: 50,658,983 D657E probably damaging Het
Ascl1 T A 10: 87,492,946 Q48L unknown Het
Asic4 T A 1: 75,451,319 V163E probably benign Het
Atm A T 9: 53,459,804 M2245K probably benign Het
Barx2 T G 9: 31,912,989 T35P probably damaging Het
BC027072 A T 17: 71,750,842 S613R probably damaging Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
C8b T A 4: 104,800,349 Y404* probably null Het
Car5a A G 8: 121,917,242 probably benign Het
Ccdc13 T C 9: 121,799,043 I169M probably benign Het
Cntfr T C 4: 41,663,322 N162D probably damaging Het
Cops3 T G 11: 59,824,345 D289A probably damaging Het
Crbn A T 6: 106,795,900 S42R probably damaging Het
Cth T A 3: 157,894,826 H397L probably benign Het
Dact2 A G 17: 14,195,748 L730P probably damaging Het
Dhx37 C T 5: 125,429,803 G210R probably benign Het
Dnah1 T C 14: 31,316,747 I126V probably benign Het
Dnttip2 T C 3: 122,278,769 I566T probably damaging Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam110b A C 4: 5,799,104 Q174P probably benign Het
Fam149a A T 8: 45,348,471 S457T probably benign Het
Fat3 A C 9: 15,960,514 V3527G probably benign Het
Fat4 A G 3: 38,891,346 M1463V probably benign Het
Gak T A 5: 108,592,352 I566F possibly damaging Het
Gdf10 T A 14: 33,932,256 I240N probably damaging Het
Gprc6a T A 10: 51,626,702 H355L probably benign Het
Gxylt1 T C 15: 93,247,899 K338R probably damaging Het
Hexim2 A T 11: 103,138,269 E49V probably null Het
Hfm1 T C 5: 106,892,772 D709G possibly damaging Het
Ighv1-49 T C 12: 115,055,461 K19R probably damaging Het
Il17a T A 1: 20,733,646 Y88* probably null Het
Iqsec1 A T 6: 90,845,361 probably benign Het
Itih2 T C 2: 10,105,196 D582G probably benign Het
Klc3 T C 7: 19,397,959 probably null Het
Larp4 T A 15: 99,986,114 N78K probably damaging Het
Larp4b A G 13: 9,168,900 D526G possibly damaging Het
Lexm A T 4: 106,610,493 H315Q probably benign Het
Limch1 T C 5: 66,974,566 V133A possibly damaging Het
Lmbr1l G A 15: 98,904,791 R426C probably damaging Het
Lox T A 18: 52,529,103 D76V probably benign Het
Lrrc8d T A 5: 105,812,552 I276N probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
March10 A T 11: 105,402,165 Y139N possibly damaging Het
Mrc1 T G 2: 14,266,515 I410S probably damaging Het
Mrto4 A T 4: 139,347,965 C176S probably damaging Het
Mtch1 G T 17: 29,347,590 D66E probably benign Het
Nbas T G 12: 13,374,811 L1017R probably damaging Het
Nim1k A G 13: 119,727,529 probably benign Het
Nlrp6 T A 7: 140,922,717 Y245* probably null Het
Olfr1264 T A 2: 90,021,665 M134L probably benign Het
Olfr192 C T 16: 59,098,819 V58I unknown Het
Olfr224 T A 11: 58,566,937 H136L probably benign Het
Olfr635 A T 7: 103,979,266 I25F probably benign Het
Olfr740 T G 14: 50,453,727 V225G probably damaging Het
Olfr906 A C 9: 38,488,539 D170A probably benign Het
Pcnx G T 12: 81,860,406 G12V probably damaging Het
Pdzd3 A G 9: 44,248,355 V448A possibly damaging Het
Pkp1 T A 1: 135,918,918 K32M probably damaging Het
Poc5 T C 13: 96,396,813 W150R probably damaging Het
Ppp1r16b T A 2: 158,757,333 probably benign Het
Prune2 T A 19: 17,020,643 M248K probably damaging Het
Rb1 A T 14: 73,213,140 probably null Het
Rhod A G 19: 4,426,587 C169R probably benign Het
Rif1 T C 2: 52,120,971 probably benign Het
Rnpc3 G A 3: 113,624,999 A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,579,931 probably benign Het
Scnn1a A T 6: 125,343,022 D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 T59K probably benign Het
Sec31a C A 5: 100,363,839 A330S probably damaging Het
Sgk3 A G 1: 9,881,872 D241G probably damaging Het
Skint6 T G 4: 113,096,591 I459L probably benign Het
Slco1a5 A T 6: 142,254,392 V222E probably damaging Het
Slit3 T A 11: 35,707,911 N1447K probably benign Het
Sorbs2 A G 8: 45,796,001 H628R probably damaging Het
St6galnac2 A G 11: 116,684,527 probably benign Het
Tbc1d31 T C 15: 57,952,871 V667A probably benign Het
Tbx20 A T 9: 24,769,720 Y159N probably damaging Het
Tmprss11b T A 5: 86,662,233 Q296L probably benign Het
Ttc6 T A 12: 57,674,594 probably null Het
Ttn T A 2: 76,870,899 probably benign Het
Tubgcp4 T A 2: 121,194,182 F613I probably benign Het
Tubgcp4 T A 2: 121,188,136 L340H probably damaging Het
Urb1 T C 16: 90,792,762 Y377C probably damaging Het
Utp15 G A 13: 98,260,846 probably null Het
Vstm2b A G 7: 40,901,283 probably null Het
Vwde A T 6: 13,190,628 V488D probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp276 A T 8: 123,265,282 probably benign Het
Zfp318 T A 17: 46,413,049 S1993T possibly damaging Het
Zfp959 T C 17: 55,897,626 L218P probably benign Het
Zxdc A G 6: 90,370,560 D301G probably damaging Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
compass UTSW 6 124329086 makesense probably null
hottish UTSW 6 124309208 missense probably damaging 1.00
protractor UTSW 6 124311566 missense probably damaging 1.00
t-square UTSW 6 124325288 missense probably damaging 0.97
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R0622:Cd163 UTSW 6 124317352 missense probably damaging 1.00
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124311447 missense probably damaging 1.00
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4425:Cd163 UTSW 6 124327903 missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124329086 makesense probably null
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5023:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5453:Cd163 UTSW 6 124312541 missense probably damaging 1.00
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5964:Cd163 UTSW 6 124326572 missense probably benign 0.01
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
R6993:Cd163 UTSW 6 124317714 missense probably damaging 1.00
R7345:Cd163 UTSW 6 124318938 missense possibly damaging 0.52
R7382:Cd163 UTSW 6 124311312 intron probably null
R7552:Cd163 UTSW 6 124307228 missense probably benign 0.08
R7829:Cd163 UTSW 6 124304779 missense probably benign 0.04
Z1177:Cd163 UTSW 6 124317385 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCTGGTTGAAAACAACAGCG -3'
(R):5'- ATGGCTGCCTTTCTTGACG -3'

Sequencing Primer
(F):5'- CAGCGTAGGTAATGACTGGGTATG -3'
(R):5'- GGTTGTGAGACATTTATCCCGCC -3'
Posted On2016-09-01