Incidental Mutation 'R5436:Tbx20'
ID428357
Institutional Source Beutler Lab
Gene Symbol Tbx20
Ensembl Gene ENSMUSG00000031965
Gene NameT-box 20
SynonymsTbx12, 9430010M06Rik
MMRRC Submission 043001-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5436 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24718138-24774303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24769720 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 159 (Y159N)
Ref Sequence ENSEMBL: ENSMUSP00000126318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052946] [ENSMUST00000166018]
Predicted Effect probably damaging
Transcript: ENSMUST00000052946
AA Change: Y159N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052591
Gene: ENSMUSG00000031965
AA Change: Y159N

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
TBOX 98 292 1.08e-122 SMART
low complexity region 339 353 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166018
AA Change: Y159N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126318
Gene: ENSMUSG00000031965
AA Change: Y159N

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
TBOX 98 292 1.08e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217597
Meta Mutation Damage Score 0.9212 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, impaired cardiac looping, a small hourglass shaped heart, and decreased cardiomyocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,764,499 K415N probably benign Het
4930449A18Rik T C 3: 59,846,693 noncoding transcript Het
Abca9 G A 11: 110,134,236 L994F probably damaging Het
Abl2 A T 1: 156,629,880 S239C probably damaging Het
Acsl5 T A 19: 55,279,565 probably null Het
Aff1 C T 5: 103,783,870 T126I probably damaging Het
Amtn T C 5: 88,381,626 L107P probably damaging Het
Ankrd45 A G 1: 161,159,112 probably benign Het
Arl6ip5 G A 6: 97,210,926 V36I probably damaging Het
Ascc3 T A 10: 50,658,983 D657E probably damaging Het
Ascl1 T A 10: 87,492,946 Q48L unknown Het
Asic4 T A 1: 75,451,319 V163E probably benign Het
Atm A T 9: 53,459,804 M2245K probably benign Het
Barx2 T G 9: 31,912,989 T35P probably damaging Het
BC027072 A T 17: 71,750,842 S613R probably damaging Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
C8b T A 4: 104,800,349 Y404* probably null Het
Car5a A G 8: 121,917,242 probably benign Het
Ccdc13 T C 9: 121,799,043 I169M probably benign Het
Cd163 A T 6: 124,327,964 D1100V probably benign Het
Cntfr T C 4: 41,663,322 N162D probably damaging Het
Cops3 T G 11: 59,824,345 D289A probably damaging Het
Crbn A T 6: 106,795,900 S42R probably damaging Het
Cth T A 3: 157,894,826 H397L probably benign Het
Dact2 A G 17: 14,195,748 L730P probably damaging Het
Dhx37 C T 5: 125,429,803 G210R probably benign Het
Dnah1 T C 14: 31,316,747 I126V probably benign Het
Dnttip2 T C 3: 122,278,769 I566T probably damaging Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam110b A C 4: 5,799,104 Q174P probably benign Het
Fam149a A T 8: 45,348,471 S457T probably benign Het
Fat3 A C 9: 15,960,514 V3527G probably benign Het
Fat4 A G 3: 38,891,346 M1463V probably benign Het
Gak T A 5: 108,592,352 I566F possibly damaging Het
Gdf10 T A 14: 33,932,256 I240N probably damaging Het
Gprc6a T A 10: 51,626,702 H355L probably benign Het
Gxylt1 T C 15: 93,247,899 K338R probably damaging Het
Hexim2 A T 11: 103,138,269 E49V probably null Het
Hfm1 T C 5: 106,892,772 D709G possibly damaging Het
Ighv1-49 T C 12: 115,055,461 K19R probably damaging Het
Il17a T A 1: 20,733,646 Y88* probably null Het
Iqsec1 A T 6: 90,845,361 probably benign Het
Itih2 T C 2: 10,105,196 D582G probably benign Het
Klc3 T C 7: 19,397,959 probably null Het
Larp4 T A 15: 99,986,114 N78K probably damaging Het
Larp4b A G 13: 9,168,900 D526G possibly damaging Het
Lexm A T 4: 106,610,493 H315Q probably benign Het
Limch1 T C 5: 66,974,566 V133A possibly damaging Het
Lmbr1l G A 15: 98,904,791 R426C probably damaging Het
Lox T A 18: 52,529,103 D76V probably benign Het
Lrrc8d T A 5: 105,812,552 I276N probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
March10 A T 11: 105,402,165 Y139N possibly damaging Het
Mrc1 T G 2: 14,266,515 I410S probably damaging Het
Mrto4 A T 4: 139,347,965 C176S probably damaging Het
Mtch1 G T 17: 29,347,590 D66E probably benign Het
Nbas T G 12: 13,374,811 L1017R probably damaging Het
Nim1k A G 13: 119,727,529 probably benign Het
Nlrp6 T A 7: 140,922,717 Y245* probably null Het
Olfr1264 T A 2: 90,021,665 M134L probably benign Het
Olfr192 C T 16: 59,098,819 V58I unknown Het
Olfr224 T A 11: 58,566,937 H136L probably benign Het
Olfr635 A T 7: 103,979,266 I25F probably benign Het
Olfr740 T G 14: 50,453,727 V225G probably damaging Het
Olfr906 A C 9: 38,488,539 D170A probably benign Het
Pcnx G T 12: 81,860,406 G12V probably damaging Het
Pdzd3 A G 9: 44,248,355 V448A possibly damaging Het
Pkp1 T A 1: 135,918,918 K32M probably damaging Het
Poc5 T C 13: 96,396,813 W150R probably damaging Het
Ppp1r16b T A 2: 158,757,333 probably benign Het
Prune2 T A 19: 17,020,643 M248K probably damaging Het
Rb1 A T 14: 73,213,140 probably null Het
Rhod A G 19: 4,426,587 C169R probably benign Het
Rif1 T C 2: 52,120,971 probably benign Het
Rnpc3 G A 3: 113,624,999 A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,579,931 probably benign Het
Scnn1a A T 6: 125,343,022 D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 T59K probably benign Het
Sec31a C A 5: 100,363,839 A330S probably damaging Het
Sgk3 A G 1: 9,881,872 D241G probably damaging Het
Skint6 T G 4: 113,096,591 I459L probably benign Het
Slco1a5 A T 6: 142,254,392 V222E probably damaging Het
Slit3 T A 11: 35,707,911 N1447K probably benign Het
Sorbs2 A G 8: 45,796,001 H628R probably damaging Het
St6galnac2 A G 11: 116,684,527 probably benign Het
Tbc1d31 T C 15: 57,952,871 V667A probably benign Het
Tmprss11b T A 5: 86,662,233 Q296L probably benign Het
Ttc6 T A 12: 57,674,594 probably null Het
Ttn T A 2: 76,870,899 probably benign Het
Tubgcp4 T A 2: 121,188,136 L340H probably damaging Het
Tubgcp4 T A 2: 121,194,182 F613I probably benign Het
Urb1 T C 16: 90,792,762 Y377C probably damaging Het
Utp15 G A 13: 98,260,846 probably null Het
Vstm2b A G 7: 40,901,283 probably null Het
Vwde A T 6: 13,190,628 V488D probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp276 A T 8: 123,265,282 probably benign Het
Zfp318 T A 17: 46,413,049 S1993T possibly damaging Het
Zfp959 T C 17: 55,897,626 L218P probably benign Het
Zxdc A G 6: 90,370,560 D301G probably damaging Het
Other mutations in Tbx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tbx20 APN 9 24758748 missense probably damaging 1.00
IGL00572:Tbx20 APN 9 24725688 missense probably benign
IGL01016:Tbx20 APN 9 24750321 missense probably damaging 1.00
IGL01317:Tbx20 APN 9 24769755 missense probably damaging 1.00
IGL02643:Tbx20 APN 9 24773713 unclassified probably benign
IGL02690:Tbx20 APN 9 24773737 missense probably benign 0.27
R0853:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0855:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0856:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R1781:Tbx20 UTSW 9 24725499 missense probably benign 0.00
R1840:Tbx20 UTSW 9 24725676 missense probably benign 0.22
R1981:Tbx20 UTSW 9 24770913 missense possibly damaging 0.85
R2063:Tbx20 UTSW 9 24769771 nonsense probably null
R2357:Tbx20 UTSW 9 24769776 missense possibly damaging 0.56
R4166:Tbx20 UTSW 9 24769744 missense probably damaging 1.00
R4790:Tbx20 UTSW 9 24725714 missense probably benign 0.34
R4904:Tbx20 UTSW 9 24758833 missense probably damaging 0.98
R5799:Tbx20 UTSW 9 24725520 nonsense probably null
R5898:Tbx20 UTSW 9 24758859 missense probably damaging 1.00
R6914:Tbx20 UTSW 9 24725483 missense probably benign 0.19
R6962:Tbx20 UTSW 9 24769740 missense probably damaging 1.00
R7556:Tbx20 UTSW 9 24750277 intron probably null
R7731:Tbx20 UTSW 9 24770697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGCCAGAATCCGATG -3'
(R):5'- AAAGTCGTGTCTCTGTGGGC -3'

Sequencing Primer
(F):5'- CTGGCCAGAATCCGATGTTTTAAAAC -3'
(R):5'- CTGTGGGCACATCTTTCATAAAC -3'
Posted On2016-09-01