Incidental Mutation 'R5436:Gprc6a'
ID 428365
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 043001-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5436 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 51502798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 355 (H355L)
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: H355L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: H355L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: H355L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T C 3: 59,754,114 (GRCm39) noncoding transcript Het
Abca9 G A 11: 110,025,062 (GRCm39) L994F probably damaging Het
Abl2 A T 1: 156,457,450 (GRCm39) S239C probably damaging Het
Acsl5 T A 19: 55,267,997 (GRCm39) probably null Het
Aff1 C T 5: 103,931,736 (GRCm39) T126I probably damaging Het
Amtn T C 5: 88,529,485 (GRCm39) L107P probably damaging Het
Ankrd45 A G 1: 160,986,682 (GRCm39) probably benign Het
Arl6ip5 G A 6: 97,187,887 (GRCm39) V36I probably damaging Het
Ascc3 T A 10: 50,535,079 (GRCm39) D657E probably damaging Het
Ascl1 T A 10: 87,328,808 (GRCm39) Q48L unknown Het
Asic4 T A 1: 75,427,963 (GRCm39) V163E probably benign Het
Atm A T 9: 53,371,104 (GRCm39) M2245K probably benign Het
Barx2 T G 9: 31,824,285 (GRCm39) T35P probably damaging Het
Bdh1 C T 16: 31,275,475 (GRCm39) R235C probably damaging Het
C8b T A 4: 104,657,546 (GRCm39) Y404* probably null Het
Car5a A G 8: 122,643,981 (GRCm39) probably benign Het
Ccdc13 T C 9: 121,628,109 (GRCm39) I169M probably benign Het
Cd163 A T 6: 124,304,923 (GRCm39) D1100V probably benign Het
Cimap2 A T 4: 106,467,690 (GRCm39) H315Q probably benign Het
Cntfr T C 4: 41,663,322 (GRCm39) N162D probably damaging Het
Cops3 T G 11: 59,715,171 (GRCm39) D289A probably damaging Het
Crbn A T 6: 106,772,861 (GRCm39) S42R probably damaging Het
Cth T A 3: 157,600,463 (GRCm39) H397L probably benign Het
Dact2 A G 17: 14,416,010 (GRCm39) L730P probably damaging Het
Dhx37 C T 5: 125,506,867 (GRCm39) G210R probably benign Het
Dnaaf9 C A 2: 130,606,419 (GRCm39) K415N probably benign Het
Dnah1 T C 14: 31,038,704 (GRCm39) I126V probably benign Het
Dnttip2 T C 3: 122,072,418 (GRCm39) I566T probably damaging Het
Ehbp1l1 G T 19: 5,766,276 (GRCm39) R412S possibly damaging Het
Fam110b A C 4: 5,799,104 (GRCm39) Q174P probably benign Het
Fam149a A T 8: 45,801,508 (GRCm39) S457T probably benign Het
Fat3 A C 9: 15,871,810 (GRCm39) V3527G probably benign Het
Fat4 A G 3: 38,945,495 (GRCm39) M1463V probably benign Het
Gak T A 5: 108,740,218 (GRCm39) I566F possibly damaging Het
Gdf10 T A 14: 33,654,213 (GRCm39) I240N probably damaging Het
Gxylt1 T C 15: 93,145,780 (GRCm39) K338R probably damaging Het
Hexim2 A T 11: 103,029,095 (GRCm39) E49V probably null Het
Hfm1 T C 5: 107,040,638 (GRCm39) D709G possibly damaging Het
Ighv1-49 T C 12: 115,019,081 (GRCm39) K19R probably damaging Het
Il17a T A 1: 20,803,870 (GRCm39) Y88* probably null Het
Iqsec1 A T 6: 90,822,343 (GRCm39) probably benign Het
Itih2 T C 2: 10,110,007 (GRCm39) D582G probably benign Het
Klc3 T C 7: 19,131,884 (GRCm39) probably null Het
Larp4 T A 15: 99,883,995 (GRCm39) N78K probably damaging Het
Larp4b A G 13: 9,218,936 (GRCm39) D526G possibly damaging Het
Limch1 T C 5: 67,131,909 (GRCm39) V133A possibly damaging Het
Lmbr1l G A 15: 98,802,672 (GRCm39) R426C probably damaging Het
Lox T A 18: 52,662,175 (GRCm39) D76V probably benign Het
Lrrc8d T A 5: 105,960,418 (GRCm39) I276N probably damaging Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Marchf10 A T 11: 105,292,991 (GRCm39) Y139N possibly damaging Het
Mrc1 T G 2: 14,271,326 (GRCm39) I410S probably damaging Het
Mrto4 A T 4: 139,075,276 (GRCm39) C176S probably damaging Het
Mtch1 G T 17: 29,566,564 (GRCm39) D66E probably benign Het
Nbas T G 12: 13,424,812 (GRCm39) L1017R probably damaging Het
Nherf4 A G 9: 44,159,652 (GRCm39) V448A possibly damaging Het
Nim1k A G 13: 120,189,065 (GRCm39) probably benign Het
Nlrp6 T A 7: 140,502,630 (GRCm39) Y245* probably null Het
Or11g7 T G 14: 50,691,184 (GRCm39) V225G probably damaging Het
Or2t43 T A 11: 58,457,763 (GRCm39) H136L probably benign Het
Or4c3 T A 2: 89,852,009 (GRCm39) M134L probably benign Het
Or51q1 A T 7: 103,628,473 (GRCm39) I25F probably benign Het
Or5h24 C T 16: 58,919,182 (GRCm39) V58I unknown Het
Or8b1 A C 9: 38,399,835 (GRCm39) D170A probably benign Het
Pcare A T 17: 72,057,837 (GRCm39) S613R probably damaging Het
Pcnx1 G T 12: 81,907,180 (GRCm39) G12V probably damaging Het
Pkp1 T A 1: 135,846,656 (GRCm39) K32M probably damaging Het
Poc5 T C 13: 96,533,321 (GRCm39) W150R probably damaging Het
Ppp1r16b T A 2: 158,599,253 (GRCm39) probably benign Het
Prune2 T A 19: 16,998,007 (GRCm39) M248K probably damaging Het
Rb1 A T 14: 73,450,580 (GRCm39) probably null Het
Rhod A G 19: 4,476,615 (GRCm39) C169R probably benign Het
Rif1 T C 2: 52,010,983 (GRCm39) probably benign Het
Rnpc3 G A 3: 113,418,648 (GRCm39) A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,229,138 (GRCm39) probably benign Het
Scnn1a A T 6: 125,319,985 (GRCm39) D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 (GRCm39) T59K probably benign Het
Sec31a C A 5: 100,511,698 (GRCm39) A330S probably damaging Het
Sgk3 A G 1: 9,952,097 (GRCm39) D241G probably damaging Het
Skint6 T G 4: 112,953,788 (GRCm39) I459L probably benign Het
Slco1a5 A T 6: 142,200,118 (GRCm39) V222E probably damaging Het
Slit3 T A 11: 35,598,738 (GRCm39) N1447K probably benign Het
Sorbs2 A G 8: 46,249,038 (GRCm39) H628R probably damaging Het
St6galnac2 A G 11: 116,575,353 (GRCm39) probably benign Het
Tbc1d31 T C 15: 57,816,267 (GRCm39) V667A probably benign Het
Tbx20 A T 9: 24,681,016 (GRCm39) Y159N probably damaging Het
Tmprss11b T A 5: 86,810,092 (GRCm39) Q296L probably benign Het
Ttc6 T A 12: 57,721,380 (GRCm39) probably null Het
Ttn T A 2: 76,701,243 (GRCm39) probably benign Het
Tubgcp4 T A 2: 121,018,617 (GRCm39) L340H probably damaging Het
Tubgcp4 T A 2: 121,024,663 (GRCm39) F613I probably benign Het
Urb1 T C 16: 90,589,650 (GRCm39) Y377C probably damaging Het
Utp15 G A 13: 98,397,354 (GRCm39) probably null Het
Vstm2b A G 7: 40,550,707 (GRCm39) probably null Het
Vwde A T 6: 13,190,627 (GRCm39) V488D probably damaging Het
Wee1 TCCCC TCCC 7: 109,723,776 (GRCm39) probably null Het
Zfp276 A T 8: 123,992,021 (GRCm39) probably benign Het
Zfp318 T A 17: 46,723,975 (GRCm39) S1993T possibly damaging Het
Zfp959 T C 17: 56,204,626 (GRCm39) L218P probably benign Het
Zxdc A G 6: 90,347,542 (GRCm39) D301G probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACACTGCAAGCTGAATGC -3'
(R):5'- TCTTCACGAAAGCCATTGAAAGG -3'

Sequencing Primer
(F):5'- TGCTATAAATGAGTCCCGGC -3'
(R):5'- AGGAAAATAAGTAAGATCTGGATTGC -3'
Posted On 2016-09-01