Incidental Mutation 'R5436:Nbas'
ID428373
Institutional Source Beutler Lab
Gene Symbol Nbas
Ensembl Gene ENSMUSG00000020576
Gene Nameneuroblastoma amplified sequence
Synonyms4933425L03Rik
MMRRC Submission 043001-MU
Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5436 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location13269133-13583811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13374811 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 1017 (L1017R)
Ref Sequence ENSEMBL: ENSMUSP00000036082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042953]
Predicted Effect probably damaging
Transcript: ENSMUST00000042953
AA Change: L1017R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: L1017R

DomainStartEndE-ValueType
Pfam:Nbas_N 89 370 4.7e-171 PFAM
low complexity region 463 475 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
Pfam:Sec39 725 1375 3.8e-34 PFAM
low complexity region 1392 1404 N/A INTRINSIC
low complexity region 1549 1566 N/A INTRINSIC
low complexity region 2226 2252 N/A INTRINSIC
low complexity region 2275 2285 N/A INTRINSIC
Meta Mutation Damage Score 0.7425 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,764,499 K415N probably benign Het
4930449A18Rik T C 3: 59,846,693 noncoding transcript Het
Abca9 G A 11: 110,134,236 L994F probably damaging Het
Abl2 A T 1: 156,629,880 S239C probably damaging Het
Acsl5 T A 19: 55,279,565 probably null Het
Aff1 C T 5: 103,783,870 T126I probably damaging Het
Amtn T C 5: 88,381,626 L107P probably damaging Het
Ankrd45 A G 1: 161,159,112 probably benign Het
Arl6ip5 G A 6: 97,210,926 V36I probably damaging Het
Ascc3 T A 10: 50,658,983 D657E probably damaging Het
Ascl1 T A 10: 87,492,946 Q48L unknown Het
Asic4 T A 1: 75,451,319 V163E probably benign Het
Atm A T 9: 53,459,804 M2245K probably benign Het
Barx2 T G 9: 31,912,989 T35P probably damaging Het
BC027072 A T 17: 71,750,842 S613R probably damaging Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
C8b T A 4: 104,800,349 Y404* probably null Het
Car5a A G 8: 121,917,242 probably benign Het
Ccdc13 T C 9: 121,799,043 I169M probably benign Het
Cd163 A T 6: 124,327,964 D1100V probably benign Het
Cntfr T C 4: 41,663,322 N162D probably damaging Het
Cops3 T G 11: 59,824,345 D289A probably damaging Het
Crbn A T 6: 106,795,900 S42R probably damaging Het
Cth T A 3: 157,894,826 H397L probably benign Het
Dact2 A G 17: 14,195,748 L730P probably damaging Het
Dhx37 C T 5: 125,429,803 G210R probably benign Het
Dnah1 T C 14: 31,316,747 I126V probably benign Het
Dnttip2 T C 3: 122,278,769 I566T probably damaging Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam110b A C 4: 5,799,104 Q174P probably benign Het
Fam149a A T 8: 45,348,471 S457T probably benign Het
Fat3 A C 9: 15,960,514 V3527G probably benign Het
Fat4 A G 3: 38,891,346 M1463V probably benign Het
Gak T A 5: 108,592,352 I566F possibly damaging Het
Gdf10 T A 14: 33,932,256 I240N probably damaging Het
Gprc6a T A 10: 51,626,702 H355L probably benign Het
Gxylt1 T C 15: 93,247,899 K338R probably damaging Het
Hexim2 A T 11: 103,138,269 E49V probably null Het
Hfm1 T C 5: 106,892,772 D709G possibly damaging Het
Ighv1-49 T C 12: 115,055,461 K19R probably damaging Het
Il17a T A 1: 20,733,646 Y88* probably null Het
Iqsec1 A T 6: 90,845,361 probably benign Het
Itih2 T C 2: 10,105,196 D582G probably benign Het
Klc3 T C 7: 19,397,959 probably null Het
Larp4 T A 15: 99,986,114 N78K probably damaging Het
Larp4b A G 13: 9,168,900 D526G possibly damaging Het
Lexm A T 4: 106,610,493 H315Q probably benign Het
Limch1 T C 5: 66,974,566 V133A possibly damaging Het
Lmbr1l G A 15: 98,904,791 R426C probably damaging Het
Lox T A 18: 52,529,103 D76V probably benign Het
Lrrc8d T A 5: 105,812,552 I276N probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
March10 A T 11: 105,402,165 Y139N possibly damaging Het
Mrc1 T G 2: 14,266,515 I410S probably damaging Het
Mrto4 A T 4: 139,347,965 C176S probably damaging Het
Mtch1 G T 17: 29,347,590 D66E probably benign Het
Nim1k A G 13: 119,727,529 probably benign Het
Nlrp6 T A 7: 140,922,717 Y245* probably null Het
Olfr1264 T A 2: 90,021,665 M134L probably benign Het
Olfr192 C T 16: 59,098,819 V58I unknown Het
Olfr224 T A 11: 58,566,937 H136L probably benign Het
Olfr635 A T 7: 103,979,266 I25F probably benign Het
Olfr740 T G 14: 50,453,727 V225G probably damaging Het
Olfr906 A C 9: 38,488,539 D170A probably benign Het
Pcnx G T 12: 81,860,406 G12V probably damaging Het
Pdzd3 A G 9: 44,248,355 V448A possibly damaging Het
Pkp1 T A 1: 135,918,918 K32M probably damaging Het
Poc5 T C 13: 96,396,813 W150R probably damaging Het
Ppp1r16b T A 2: 158,757,333 probably benign Het
Prune2 T A 19: 17,020,643 M248K probably damaging Het
Rb1 A T 14: 73,213,140 probably null Het
Rhod A G 19: 4,426,587 C169R probably benign Het
Rif1 T C 2: 52,120,971 probably benign Het
Rnpc3 G A 3: 113,624,999 A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,579,931 probably benign Het
Scnn1a A T 6: 125,343,022 D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 T59K probably benign Het
Sec31a C A 5: 100,363,839 A330S probably damaging Het
Sgk3 A G 1: 9,881,872 D241G probably damaging Het
Skint6 T G 4: 113,096,591 I459L probably benign Het
Slco1a5 A T 6: 142,254,392 V222E probably damaging Het
Slit3 T A 11: 35,707,911 N1447K probably benign Het
Sorbs2 A G 8: 45,796,001 H628R probably damaging Het
St6galnac2 A G 11: 116,684,527 probably benign Het
Tbc1d31 T C 15: 57,952,871 V667A probably benign Het
Tbx20 A T 9: 24,769,720 Y159N probably damaging Het
Tmprss11b T A 5: 86,662,233 Q296L probably benign Het
Ttc6 T A 12: 57,674,594 probably null Het
Ttn T A 2: 76,870,899 probably benign Het
Tubgcp4 T A 2: 121,188,136 L340H probably damaging Het
Tubgcp4 T A 2: 121,194,182 F613I probably benign Het
Urb1 T C 16: 90,792,762 Y377C probably damaging Het
Utp15 G A 13: 98,260,846 probably null Het
Vstm2b A G 7: 40,901,283 probably null Het
Vwde A T 6: 13,190,628 V488D probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp276 A T 8: 123,265,282 probably benign Het
Zfp318 T A 17: 46,413,049 S1993T possibly damaging Het
Zfp959 T C 17: 55,897,626 L218P probably benign Het
Zxdc A G 6: 90,370,560 D301G probably damaging Het
Other mutations in Nbas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Nbas APN 12 13453075 missense probably benign 0.19
IGL00712:Nbas APN 12 13362625 splice site probably benign
IGL00808:Nbas APN 12 13566120 splice site probably benign
IGL00915:Nbas APN 12 13374752 nonsense probably null
IGL00923:Nbas APN 12 13336284 missense possibly damaging 0.46
IGL01152:Nbas APN 12 13360958 missense probably damaging 1.00
IGL01633:Nbas APN 12 13483897 missense probably damaging 1.00
IGL01672:Nbas APN 12 13379649 missense possibly damaging 0.63
IGL01799:Nbas APN 12 13324400 splice site probably benign
IGL01812:Nbas APN 12 13453503 missense probably damaging 1.00
IGL01934:Nbas APN 12 13289879 splice site probably benign
IGL02093:Nbas APN 12 13560962 missense probably benign 0.00
IGL02115:Nbas APN 12 13317692 splice site probably benign
IGL02175:Nbas APN 12 13566259 critical splice donor site probably null
IGL02268:Nbas APN 12 13405397 missense possibly damaging 0.94
IGL02483:Nbas APN 12 13324294 missense probably damaging 1.00
IGL02539:Nbas APN 12 13272703 splice site probably benign
IGL02557:Nbas APN 12 13361028 missense probably damaging 1.00
IGL02815:Nbas APN 12 13310266 missense probably damaging 1.00
IGL02951:Nbas APN 12 13362541 missense probably benign
IGL03131:Nbas APN 12 13279416 missense probably benign 0.03
IGL03214:Nbas APN 12 13331110 splice site probably benign
IGL03308:Nbas APN 12 13324348 missense possibly damaging 0.93
IGL03368:Nbas APN 12 13328451 missense probably benign 0.08
IGL03372:Nbas APN 12 13534472 missense probably damaging 1.00
IGL03391:Nbas APN 12 13483749 missense probably benign 0.28
medvedev UTSW 12 13534577 critical splice donor site probably null
oligarchs UTSW 12 13520750 missense possibly damaging 0.75
putin UTSW 12 13321755 missense probably damaging 1.00
1mM(1):Nbas UTSW 12 13288728 missense probably damaging 1.00
R0057:Nbas UTSW 12 13390957 missense probably benign 0.00
R0076:Nbas UTSW 12 13324336 missense probably damaging 1.00
R0153:Nbas UTSW 12 13273876 splice site probably benign
R0371:Nbas UTSW 12 13331095 missense probably damaging 0.97
R0449:Nbas UTSW 12 13519108 missense probably benign 0.18
R0791:Nbas UTSW 12 13482633 missense probably benign 0.28
R0931:Nbas UTSW 12 13331114 splice site probably benign
R1236:Nbas UTSW 12 13269241 missense probably damaging 1.00
R1371:Nbas UTSW 12 13482378 splice site probably benign
R1567:Nbas UTSW 12 13285278 missense possibly damaging 0.70
R1587:Nbas UTSW 12 13558685 missense probably benign
R1719:Nbas UTSW 12 13560977 critical splice donor site probably null
R1747:Nbas UTSW 12 13335898 missense probably benign 0.00
R1777:Nbas UTSW 12 13513562 missense probably benign 0.16
R1848:Nbas UTSW 12 13413597 missense probably damaging 0.97
R1856:Nbas UTSW 12 13474229 missense possibly damaging 0.56
R1891:Nbas UTSW 12 13390972 missense possibly damaging 0.92
R1911:Nbas UTSW 12 13566144 missense probably benign
R1912:Nbas UTSW 12 13566144 missense probably benign
R2006:Nbas UTSW 12 13414741 intron probably null
R2054:Nbas UTSW 12 13474206 missense probably benign 0.36
R2065:Nbas UTSW 12 13566157 missense probably damaging 1.00
R2089:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2156:Nbas UTSW 12 13441509 missense probably damaging 1.00
R2164:Nbas UTSW 12 13330646 missense possibly damaging 0.74
R2339:Nbas UTSW 12 13362592 missense probably benign 0.12
R2398:Nbas UTSW 12 13432945 missense probably damaging 0.99
R3806:Nbas UTSW 12 13482504 missense probably damaging 1.00
R3855:Nbas UTSW 12 13279414 missense possibly damaging 0.50
R4019:Nbas UTSW 12 13482519 missense probably damaging 1.00
R4083:Nbas UTSW 12 13474191 missense probably damaging 0.96
R4201:Nbas UTSW 12 13374826 missense probably benign 0.00
R4231:Nbas UTSW 12 13393343 missense probably damaging 0.98
R4552:Nbas UTSW 12 13335937 critical splice donor site probably null
R4560:Nbas UTSW 12 13583527 missense probably benign 0.00
R4728:Nbas UTSW 12 13288739 missense probably damaging 0.98
R4752:Nbas UTSW 12 13482537 missense possibly damaging 0.92
R4832:Nbas UTSW 12 13483739 missense probably benign 0.00
R4874:Nbas UTSW 12 13321755 missense probably damaging 1.00
R4988:Nbas UTSW 12 13408265 missense probably benign 0.45
R5020:Nbas UTSW 12 13374712 missense probably damaging 0.99
R5079:Nbas UTSW 12 13374711 missense probably damaging 1.00
R5129:Nbas UTSW 12 13390960 missense probably damaging 1.00
R5239:Nbas UTSW 12 13441518 missense probably benign 0.31
R5299:Nbas UTSW 12 13441925 nonsense probably null
R5351:Nbas UTSW 12 13560849 missense probably damaging 1.00
R5389:Nbas UTSW 12 13534577 critical splice donor site probably null
R5654:Nbas UTSW 12 13583475 missense probably damaging 1.00
R5690:Nbas UTSW 12 13336284 missense probably damaging 1.00
R5842:Nbas UTSW 12 13269266 critical splice donor site probably null
R5959:Nbas UTSW 12 13288801 missense probably damaging 0.99
R5982:Nbas UTSW 12 13393430 missense probably benign 0.00
R6238:Nbas UTSW 12 13482595 missense probably benign
R6270:Nbas UTSW 12 13324293 missense probably damaging 1.00
R6363:Nbas UTSW 12 13482576 missense probably benign
R6424:Nbas UTSW 12 13415733 critical splice donor site probably null
R6458:Nbas UTSW 12 13288749 missense probably damaging 1.00
R6526:Nbas UTSW 12 13405425 missense probably damaging 1.00
R6654:Nbas UTSW 12 13483874 nonsense probably null
R7085:Nbas UTSW 12 13285258 missense probably damaging 1.00
R7179:Nbas UTSW 12 13405397 missense possibly damaging 0.94
R7197:Nbas UTSW 12 13520750 missense possibly damaging 0.75
R7378:Nbas UTSW 12 13274219 missense probably damaging 1.00
R7393:Nbas UTSW 12 13393492 missense probably damaging 1.00
R7425:Nbas UTSW 12 13469880 missense probably damaging 1.00
R7446:Nbas UTSW 12 13393498 missense probably benign 0.02
R7481:Nbas UTSW 12 13356959 missense probably damaging 0.97
R7535:Nbas UTSW 12 13279389 missense probably damaging 0.97
R7626:Nbas UTSW 12 13558660 missense probably benign 0.00
R7678:Nbas UTSW 12 13415661 missense probably damaging 0.97
R7912:Nbas UTSW 12 13405457 missense possibly damaging 0.91
R8193:Nbas UTSW 12 13433009 missense probably damaging 1.00
RF013:Nbas UTSW 12 13279408 missense possibly damaging 0.54
T0722:Nbas UTSW 12 13352808 missense probably benign 0.00
Z1176:Nbas UTSW 12 13483876 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTTGGCTGATTAATGGCACTG -3'
(R):5'- CAAGGCCACGTGAATATAGAGCAC -3'

Sequencing Primer
(F):5'- CTATTGAAAGTGGTACTGGGATATG -3'
(R):5'- CGTGAATATAGAGCACTCACCC -3'
Posted On2016-09-01