Incidental Mutation 'R5436:Utp15'
ID 428377
Institutional Source Beutler Lab
Gene Symbol Utp15
Ensembl Gene ENSMUSG00000041747
Gene Name UTP15 small subunit processome component
Synonyms
MMRRC Submission 043001-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock # R5436 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 98246845-98263041 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 98260846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022164] [ENSMUST00000040972] [ENSMUST00000091356] [ENSMUST00000123924] [ENSMUST00000150352] [ENSMUST00000150916] [ENSMUST00000226100]
AlphaFold Q8C7V3
Predicted Effect probably null
Transcript: ENSMUST00000022164
SMART Domains Protein: ENSMUSP00000022164
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Blast:ANK 279 308 1e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000040972
AA Change: L15F

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048204
Gene: ENSMUSG00000041747
AA Change: L15F

DomainStartEndE-ValueType
WD40 31 66 6.85e1 SMART
WD40 69 108 1.66e-5 SMART
WD40 111 150 2.82e-8 SMART
WD40 153 193 7.33e-7 SMART
WD40 196 233 3.9e-2 SMART
WD40 237 276 1.39e-7 SMART
WD40 279 317 1.7e2 SMART
Pfam:UTP15_C 343 490 3.5e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000091356
SMART Domains Protein: ENSMUSP00000088915
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123924
SMART Domains Protein: ENSMUSP00000122701
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150352
SMART Domains Protein: ENSMUSP00000117508
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150916
SMART Domains Protein: ENSMUSP00000116590
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224842
Predicted Effect probably null
Transcript: ENSMUST00000226100
Meta Mutation Damage Score 0.2424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,764,499 K415N probably benign Het
4930449A18Rik T C 3: 59,846,693 noncoding transcript Het
Abca9 G A 11: 110,134,236 L994F probably damaging Het
Abl2 A T 1: 156,629,880 S239C probably damaging Het
Acsl5 T A 19: 55,279,565 probably null Het
Aff1 C T 5: 103,783,870 T126I probably damaging Het
Amtn T C 5: 88,381,626 L107P probably damaging Het
Ankrd45 A G 1: 161,159,112 probably benign Het
Arl6ip5 G A 6: 97,210,926 V36I probably damaging Het
Ascc3 T A 10: 50,658,983 D657E probably damaging Het
Ascl1 T A 10: 87,492,946 Q48L unknown Het
Asic4 T A 1: 75,451,319 V163E probably benign Het
Atm A T 9: 53,459,804 M2245K probably benign Het
Barx2 T G 9: 31,912,989 T35P probably damaging Het
BC027072 A T 17: 71,750,842 S613R probably damaging Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
C8b T A 4: 104,800,349 Y404* probably null Het
Car5a A G 8: 121,917,242 probably benign Het
Ccdc13 T C 9: 121,799,043 I169M probably benign Het
Cd163 A T 6: 124,327,964 D1100V probably benign Het
Cntfr T C 4: 41,663,322 N162D probably damaging Het
Cops3 T G 11: 59,824,345 D289A probably damaging Het
Crbn A T 6: 106,795,900 S42R probably damaging Het
Cth T A 3: 157,894,826 H397L probably benign Het
Dact2 A G 17: 14,195,748 L730P probably damaging Het
Dhx37 C T 5: 125,429,803 G210R probably benign Het
Dnah1 T C 14: 31,316,747 I126V probably benign Het
Dnttip2 T C 3: 122,278,769 I566T probably damaging Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam110b A C 4: 5,799,104 Q174P probably benign Het
Fam149a A T 8: 45,348,471 S457T probably benign Het
Fat3 A C 9: 15,960,514 V3527G probably benign Het
Fat4 A G 3: 38,891,346 M1463V probably benign Het
Gak T A 5: 108,592,352 I566F possibly damaging Het
Gdf10 T A 14: 33,932,256 I240N probably damaging Het
Gprc6a T A 10: 51,626,702 H355L probably benign Het
Gxylt1 T C 15: 93,247,899 K338R probably damaging Het
Hexim2 A T 11: 103,138,269 E49V probably null Het
Hfm1 T C 5: 106,892,772 D709G possibly damaging Het
Ighv1-49 T C 12: 115,055,461 K19R probably damaging Het
Il17a T A 1: 20,733,646 Y88* probably null Het
Iqsec1 A T 6: 90,845,361 probably benign Het
Itih2 T C 2: 10,105,196 D582G probably benign Het
Klc3 T C 7: 19,397,959 probably null Het
Larp4 T A 15: 99,986,114 N78K probably damaging Het
Larp4b A G 13: 9,168,900 D526G possibly damaging Het
Lexm A T 4: 106,610,493 H315Q probably benign Het
Limch1 T C 5: 66,974,566 V133A possibly damaging Het
Lmbr1l G A 15: 98,904,791 R426C probably damaging Het
Lox T A 18: 52,529,103 D76V probably benign Het
Lrrc8d T A 5: 105,812,552 I276N probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
March10 A T 11: 105,402,165 Y139N possibly damaging Het
Mrc1 T G 2: 14,266,515 I410S probably damaging Het
Mrto4 A T 4: 139,347,965 C176S probably damaging Het
Mtch1 G T 17: 29,347,590 D66E probably benign Het
Nbas T G 12: 13,374,811 L1017R probably damaging Het
Nim1k A G 13: 119,727,529 probably benign Het
Nlrp6 T A 7: 140,922,717 Y245* probably null Het
Olfr1264 T A 2: 90,021,665 M134L probably benign Het
Olfr192 C T 16: 59,098,819 V58I unknown Het
Olfr224 T A 11: 58,566,937 H136L probably benign Het
Olfr635 A T 7: 103,979,266 I25F probably benign Het
Olfr740 T G 14: 50,453,727 V225G probably damaging Het
Olfr906 A C 9: 38,488,539 D170A probably benign Het
Pcnx G T 12: 81,860,406 G12V probably damaging Het
Pdzd3 A G 9: 44,248,355 V448A possibly damaging Het
Pkp1 T A 1: 135,918,918 K32M probably damaging Het
Poc5 T C 13: 96,396,813 W150R probably damaging Het
Ppp1r16b T A 2: 158,757,333 probably benign Het
Prune2 T A 19: 17,020,643 M248K probably damaging Het
Rb1 A T 14: 73,213,140 probably null Het
Rhod A G 19: 4,426,587 C169R probably benign Het
Rif1 T C 2: 52,120,971 probably benign Het
Rnpc3 G A 3: 113,624,999 A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,579,931 probably benign Het
Scnn1a A T 6: 125,343,022 D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 T59K probably benign Het
Sec31a C A 5: 100,363,839 A330S probably damaging Het
Sgk3 A G 1: 9,881,872 D241G probably damaging Het
Skint6 T G 4: 113,096,591 I459L probably benign Het
Slco1a5 A T 6: 142,254,392 V222E probably damaging Het
Slit3 T A 11: 35,707,911 N1447K probably benign Het
Sorbs2 A G 8: 45,796,001 H628R probably damaging Het
St6galnac2 A G 11: 116,684,527 probably benign Het
Tbc1d31 T C 15: 57,952,871 V667A probably benign Het
Tbx20 A T 9: 24,769,720 Y159N probably damaging Het
Tmprss11b T A 5: 86,662,233 Q296L probably benign Het
Ttc6 T A 12: 57,674,594 probably null Het
Ttn T A 2: 76,870,899 probably benign Het
Tubgcp4 T A 2: 121,188,136 L340H probably damaging Het
Tubgcp4 T A 2: 121,194,182 F613I probably benign Het
Urb1 T C 16: 90,792,762 Y377C probably damaging Het
Vstm2b A G 7: 40,901,283 probably null Het
Vwde A T 6: 13,190,628 V488D probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp276 A T 8: 123,265,282 probably benign Het
Zfp318 T A 17: 46,413,049 S1993T possibly damaging Het
Zfp959 T C 17: 55,897,626 L218P probably benign Het
Zxdc A G 6: 90,370,560 D301G probably damaging Het
Other mutations in Utp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02951:Utp15 APN 13 98257952 missense probably damaging 1.00
IGL02960:Utp15 APN 13 98252881 missense probably benign 0.30
IGL03271:Utp15 APN 13 98253694 missense probably damaging 1.00
R0125:Utp15 UTSW 13 98250882 missense possibly damaging 0.81
R0679:Utp15 UTSW 13 98259403 missense probably benign 0.13
R1447:Utp15 UTSW 13 98252878 missense possibly damaging 0.68
R1618:Utp15 UTSW 13 98257187 missense probably benign 0.16
R1992:Utp15 UTSW 13 98250912 missense probably benign
R2110:Utp15 UTSW 13 98254985 missense probably damaging 1.00
R2263:Utp15 UTSW 13 98257925 missense probably benign 0.03
R3888:Utp15 UTSW 13 98259166 missense probably benign 0.00
R4355:Utp15 UTSW 13 98259247 missense possibly damaging 0.48
R5568:Utp15 UTSW 13 98257925 missense probably benign 0.03
R6489:Utp15 UTSW 13 98250609 missense probably damaging 0.96
R8116:Utp15 UTSW 13 98250863 missense probably benign
R8360:Utp15 UTSW 13 98254991 missense probably damaging 1.00
R9049:Utp15 UTSW 13 98259270 missense probably damaging 1.00
R9370:Utp15 UTSW 13 98250611 missense probably damaging 0.96
R9654:Utp15 UTSW 13 98249160 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTGTTAAGCAGCTGCATG -3'
(R):5'- CTATAAAGTTCCACACAGCCTTTTG -3'

Sequencing Primer
(F):5'- GCAGCTGCATGGTCAAAATAATTAAG -3'
(R):5'- GTTCCACACAGCCTTTTGAAAGAAAG -3'
Posted On 2016-09-01