Incidental Mutation 'R5436:Dnah1'
ID428379
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 043001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5436 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31316747 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 126 (I126V)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably benign
Transcript: ENSMUST00000048603
AA Change: I126V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: I126V

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228755
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,764,499 K415N probably benign Het
4930449A18Rik T C 3: 59,846,693 noncoding transcript Het
Abca9 G A 11: 110,134,236 L994F probably damaging Het
Abl2 A T 1: 156,629,880 S239C probably damaging Het
Acsl5 T A 19: 55,279,565 probably null Het
Aff1 C T 5: 103,783,870 T126I probably damaging Het
Amtn T C 5: 88,381,626 L107P probably damaging Het
Ankrd45 A G 1: 161,159,112 probably benign Het
Arl6ip5 G A 6: 97,210,926 V36I probably damaging Het
Ascc3 T A 10: 50,658,983 D657E probably damaging Het
Ascl1 T A 10: 87,492,946 Q48L unknown Het
Asic4 T A 1: 75,451,319 V163E probably benign Het
Atm A T 9: 53,459,804 M2245K probably benign Het
Barx2 T G 9: 31,912,989 T35P probably damaging Het
BC027072 A T 17: 71,750,842 S613R probably damaging Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
C8b T A 4: 104,800,349 Y404* probably null Het
Car5a A G 8: 121,917,242 probably benign Het
Ccdc13 T C 9: 121,799,043 I169M probably benign Het
Cd163 A T 6: 124,327,964 D1100V probably benign Het
Cntfr T C 4: 41,663,322 N162D probably damaging Het
Cops3 T G 11: 59,824,345 D289A probably damaging Het
Crbn A T 6: 106,795,900 S42R probably damaging Het
Cth T A 3: 157,894,826 H397L probably benign Het
Dact2 A G 17: 14,195,748 L730P probably damaging Het
Dhx37 C T 5: 125,429,803 G210R probably benign Het
Dnttip2 T C 3: 122,278,769 I566T probably damaging Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam110b A C 4: 5,799,104 Q174P probably benign Het
Fam149a A T 8: 45,348,471 S457T probably benign Het
Fat3 A C 9: 15,960,514 V3527G probably benign Het
Fat4 A G 3: 38,891,346 M1463V probably benign Het
Gak T A 5: 108,592,352 I566F possibly damaging Het
Gdf10 T A 14: 33,932,256 I240N probably damaging Het
Gprc6a T A 10: 51,626,702 H355L probably benign Het
Gxylt1 T C 15: 93,247,899 K338R probably damaging Het
Hexim2 A T 11: 103,138,269 E49V probably null Het
Hfm1 T C 5: 106,892,772 D709G possibly damaging Het
Ighv1-49 T C 12: 115,055,461 K19R probably damaging Het
Il17a T A 1: 20,733,646 Y88* probably null Het
Iqsec1 A T 6: 90,845,361 probably benign Het
Itih2 T C 2: 10,105,196 D582G probably benign Het
Klc3 T C 7: 19,397,959 probably null Het
Larp4 T A 15: 99,986,114 N78K probably damaging Het
Larp4b A G 13: 9,168,900 D526G possibly damaging Het
Lexm A T 4: 106,610,493 H315Q probably benign Het
Limch1 T C 5: 66,974,566 V133A possibly damaging Het
Lmbr1l G A 15: 98,904,791 R426C probably damaging Het
Lox T A 18: 52,529,103 D76V probably benign Het
Lrrc8d T A 5: 105,812,552 I276N probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
March10 A T 11: 105,402,165 Y139N possibly damaging Het
Mrc1 T G 2: 14,266,515 I410S probably damaging Het
Mrto4 A T 4: 139,347,965 C176S probably damaging Het
Mtch1 G T 17: 29,347,590 D66E probably benign Het
Nbas T G 12: 13,374,811 L1017R probably damaging Het
Nim1k A G 13: 119,727,529 probably benign Het
Nlrp6 T A 7: 140,922,717 Y245* probably null Het
Olfr1264 T A 2: 90,021,665 M134L probably benign Het
Olfr192 C T 16: 59,098,819 V58I unknown Het
Olfr224 T A 11: 58,566,937 H136L probably benign Het
Olfr635 A T 7: 103,979,266 I25F probably benign Het
Olfr740 T G 14: 50,453,727 V225G probably damaging Het
Olfr906 A C 9: 38,488,539 D170A probably benign Het
Pcnx G T 12: 81,860,406 G12V probably damaging Het
Pdzd3 A G 9: 44,248,355 V448A possibly damaging Het
Pkp1 T A 1: 135,918,918 K32M probably damaging Het
Poc5 T C 13: 96,396,813 W150R probably damaging Het
Ppp1r16b T A 2: 158,757,333 probably benign Het
Prune2 T A 19: 17,020,643 M248K probably damaging Het
Rb1 A T 14: 73,213,140 probably null Het
Rhod A G 19: 4,426,587 C169R probably benign Het
Rif1 T C 2: 52,120,971 probably benign Het
Rnpc3 G A 3: 113,624,999 A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,579,931 probably benign Het
Scnn1a A T 6: 125,343,022 D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 T59K probably benign Het
Sec31a C A 5: 100,363,839 A330S probably damaging Het
Sgk3 A G 1: 9,881,872 D241G probably damaging Het
Skint6 T G 4: 113,096,591 I459L probably benign Het
Slco1a5 A T 6: 142,254,392 V222E probably damaging Het
Slit3 T A 11: 35,707,911 N1447K probably benign Het
Sorbs2 A G 8: 45,796,001 H628R probably damaging Het
St6galnac2 A G 11: 116,684,527 probably benign Het
Tbc1d31 T C 15: 57,952,871 V667A probably benign Het
Tbx20 A T 9: 24,769,720 Y159N probably damaging Het
Tmprss11b T A 5: 86,662,233 Q296L probably benign Het
Ttc6 T A 12: 57,674,594 probably null Het
Ttn T A 2: 76,870,899 probably benign Het
Tubgcp4 T A 2: 121,188,136 L340H probably damaging Het
Tubgcp4 T A 2: 121,194,182 F613I probably benign Het
Urb1 T C 16: 90,792,762 Y377C probably damaging Het
Utp15 G A 13: 98,260,846 probably null Het
Vstm2b A G 7: 40,901,283 probably null Het
Vwde A T 6: 13,190,628 V488D probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp276 A T 8: 123,265,282 probably benign Het
Zfp318 T A 17: 46,413,049 S1993T possibly damaging Het
Zfp959 T C 17: 55,897,626 L218P probably benign Het
Zxdc A G 6: 90,370,560 D301G probably damaging Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
Faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31261590 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31300791 missense possibly damaging 0.80
R7499:Dnah1 UTSW 14 31315122 nonsense probably null
R7526:Dnah1 UTSW 14 31287876 missense possibly damaging 0.49
R7560:Dnah1 UTSW 14 31304983 missense probably benign
R7574:Dnah1 UTSW 14 31319908 missense probably benign 0.00
R7617:Dnah1 UTSW 14 31284782 missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31303906 missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31292338 missense probably benign 0.00
R7702:Dnah1 UTSW 14 31310909 missense probably benign
R7786:Dnah1 UTSW 14 31262521 missense probably damaging 1.00
RF006:Dnah1 UTSW 14 31307875 missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGGCAGATGCTACCTCCTTG -3'
(R):5'- AGAACAGCCCATGGTTTCTC -3'

Sequencing Primer
(F):5'- ATGCTACCTCCTTGGGCCAG -3'
(R):5'- AGAACAGCCCATGGTTTCTCATTTC -3'
Posted On2016-09-01