Incidental Mutation 'R5436:Dact2'
ID 428390
Institutional Source Beutler Lab
Gene Symbol Dact2
Ensembl Gene ENSMUSG00000048826
Gene Name dishevelled-binding antagonist of beta-catenin 2
Synonyms 2900084M21Rik, Frd2, Dpr2, dapper2
MMRRC Submission 043001-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5436 (G1)
Quality Score 214
Status Validated
Chromosome 17
Chromosomal Location 14415492-14424595 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14416010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 730 (L730P)
Ref Sequence ENSEMBL: ENSMUSP00000051638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053218]
AlphaFold Q7TN08
Predicted Effect probably damaging
Transcript: ENSMUST00000053218
AA Change: L730P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051638
Gene: ENSMUSG00000048826
AA Change: L730P

DomainStartEndE-ValueType
Pfam:Dapper 19 757 1.8e-231 PFAM
Meta Mutation Damage Score 0.4234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele develop normally but display enhanced keratinocyte migration and accelerated re-epithelialization during cutaneous wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T C 3: 59,754,114 (GRCm39) noncoding transcript Het
Abca9 G A 11: 110,025,062 (GRCm39) L994F probably damaging Het
Abl2 A T 1: 156,457,450 (GRCm39) S239C probably damaging Het
Acsl5 T A 19: 55,267,997 (GRCm39) probably null Het
Aff1 C T 5: 103,931,736 (GRCm39) T126I probably damaging Het
Amtn T C 5: 88,529,485 (GRCm39) L107P probably damaging Het
Ankrd45 A G 1: 160,986,682 (GRCm39) probably benign Het
Arl6ip5 G A 6: 97,187,887 (GRCm39) V36I probably damaging Het
Ascc3 T A 10: 50,535,079 (GRCm39) D657E probably damaging Het
Ascl1 T A 10: 87,328,808 (GRCm39) Q48L unknown Het
Asic4 T A 1: 75,427,963 (GRCm39) V163E probably benign Het
Atm A T 9: 53,371,104 (GRCm39) M2245K probably benign Het
Barx2 T G 9: 31,824,285 (GRCm39) T35P probably damaging Het
Bdh1 C T 16: 31,275,475 (GRCm39) R235C probably damaging Het
C8b T A 4: 104,657,546 (GRCm39) Y404* probably null Het
Car5a A G 8: 122,643,981 (GRCm39) probably benign Het
Ccdc13 T C 9: 121,628,109 (GRCm39) I169M probably benign Het
Cd163 A T 6: 124,304,923 (GRCm39) D1100V probably benign Het
Cimap2 A T 4: 106,467,690 (GRCm39) H315Q probably benign Het
Cntfr T C 4: 41,663,322 (GRCm39) N162D probably damaging Het
Cops3 T G 11: 59,715,171 (GRCm39) D289A probably damaging Het
Crbn A T 6: 106,772,861 (GRCm39) S42R probably damaging Het
Cth T A 3: 157,600,463 (GRCm39) H397L probably benign Het
Dhx37 C T 5: 125,506,867 (GRCm39) G210R probably benign Het
Dnaaf9 C A 2: 130,606,419 (GRCm39) K415N probably benign Het
Dnah1 T C 14: 31,038,704 (GRCm39) I126V probably benign Het
Dnttip2 T C 3: 122,072,418 (GRCm39) I566T probably damaging Het
Ehbp1l1 G T 19: 5,766,276 (GRCm39) R412S possibly damaging Het
Fam110b A C 4: 5,799,104 (GRCm39) Q174P probably benign Het
Fam149a A T 8: 45,801,508 (GRCm39) S457T probably benign Het
Fat3 A C 9: 15,871,810 (GRCm39) V3527G probably benign Het
Fat4 A G 3: 38,945,495 (GRCm39) M1463V probably benign Het
Gak T A 5: 108,740,218 (GRCm39) I566F possibly damaging Het
Gdf10 T A 14: 33,654,213 (GRCm39) I240N probably damaging Het
Gprc6a T A 10: 51,502,798 (GRCm39) H355L probably benign Het
Gxylt1 T C 15: 93,145,780 (GRCm39) K338R probably damaging Het
Hexim2 A T 11: 103,029,095 (GRCm39) E49V probably null Het
Hfm1 T C 5: 107,040,638 (GRCm39) D709G possibly damaging Het
Ighv1-49 T C 12: 115,019,081 (GRCm39) K19R probably damaging Het
Il17a T A 1: 20,803,870 (GRCm39) Y88* probably null Het
Iqsec1 A T 6: 90,822,343 (GRCm39) probably benign Het
Itih2 T C 2: 10,110,007 (GRCm39) D582G probably benign Het
Klc3 T C 7: 19,131,884 (GRCm39) probably null Het
Larp4 T A 15: 99,883,995 (GRCm39) N78K probably damaging Het
Larp4b A G 13: 9,218,936 (GRCm39) D526G possibly damaging Het
Limch1 T C 5: 67,131,909 (GRCm39) V133A possibly damaging Het
Lmbr1l G A 15: 98,802,672 (GRCm39) R426C probably damaging Het
Lox T A 18: 52,662,175 (GRCm39) D76V probably benign Het
Lrrc8d T A 5: 105,960,418 (GRCm39) I276N probably damaging Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Marchf10 A T 11: 105,292,991 (GRCm39) Y139N possibly damaging Het
Mrc1 T G 2: 14,271,326 (GRCm39) I410S probably damaging Het
Mrto4 A T 4: 139,075,276 (GRCm39) C176S probably damaging Het
Mtch1 G T 17: 29,566,564 (GRCm39) D66E probably benign Het
Nbas T G 12: 13,424,812 (GRCm39) L1017R probably damaging Het
Nherf4 A G 9: 44,159,652 (GRCm39) V448A possibly damaging Het
Nim1k A G 13: 120,189,065 (GRCm39) probably benign Het
Nlrp6 T A 7: 140,502,630 (GRCm39) Y245* probably null Het
Or11g7 T G 14: 50,691,184 (GRCm39) V225G probably damaging Het
Or2t43 T A 11: 58,457,763 (GRCm39) H136L probably benign Het
Or4c3 T A 2: 89,852,009 (GRCm39) M134L probably benign Het
Or51q1 A T 7: 103,628,473 (GRCm39) I25F probably benign Het
Or5h24 C T 16: 58,919,182 (GRCm39) V58I unknown Het
Or8b1 A C 9: 38,399,835 (GRCm39) D170A probably benign Het
Pcare A T 17: 72,057,837 (GRCm39) S613R probably damaging Het
Pcnx1 G T 12: 81,907,180 (GRCm39) G12V probably damaging Het
Pkp1 T A 1: 135,846,656 (GRCm39) K32M probably damaging Het
Poc5 T C 13: 96,533,321 (GRCm39) W150R probably damaging Het
Ppp1r16b T A 2: 158,599,253 (GRCm39) probably benign Het
Prune2 T A 19: 16,998,007 (GRCm39) M248K probably damaging Het
Rb1 A T 14: 73,450,580 (GRCm39) probably null Het
Rhod A G 19: 4,476,615 (GRCm39) C169R probably benign Het
Rif1 T C 2: 52,010,983 (GRCm39) probably benign Het
Rnpc3 G A 3: 113,418,648 (GRCm39) A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,229,138 (GRCm39) probably benign Het
Scnn1a A T 6: 125,319,985 (GRCm39) D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 (GRCm39) T59K probably benign Het
Sec31a C A 5: 100,511,698 (GRCm39) A330S probably damaging Het
Sgk3 A G 1: 9,952,097 (GRCm39) D241G probably damaging Het
Skint6 T G 4: 112,953,788 (GRCm39) I459L probably benign Het
Slco1a5 A T 6: 142,200,118 (GRCm39) V222E probably damaging Het
Slit3 T A 11: 35,598,738 (GRCm39) N1447K probably benign Het
Sorbs2 A G 8: 46,249,038 (GRCm39) H628R probably damaging Het
St6galnac2 A G 11: 116,575,353 (GRCm39) probably benign Het
Tbc1d31 T C 15: 57,816,267 (GRCm39) V667A probably benign Het
Tbx20 A T 9: 24,681,016 (GRCm39) Y159N probably damaging Het
Tmprss11b T A 5: 86,810,092 (GRCm39) Q296L probably benign Het
Ttc6 T A 12: 57,721,380 (GRCm39) probably null Het
Ttn T A 2: 76,701,243 (GRCm39) probably benign Het
Tubgcp4 T A 2: 121,018,617 (GRCm39) L340H probably damaging Het
Tubgcp4 T A 2: 121,024,663 (GRCm39) F613I probably benign Het
Urb1 T C 16: 90,589,650 (GRCm39) Y377C probably damaging Het
Utp15 G A 13: 98,397,354 (GRCm39) probably null Het
Vstm2b A G 7: 40,550,707 (GRCm39) probably null Het
Vwde A T 6: 13,190,627 (GRCm39) V488D probably damaging Het
Wee1 TCCCC TCCC 7: 109,723,776 (GRCm39) probably null Het
Zfp276 A T 8: 123,992,021 (GRCm39) probably benign Het
Zfp318 T A 17: 46,723,975 (GRCm39) S1993T possibly damaging Het
Zfp959 T C 17: 56,204,626 (GRCm39) L218P probably benign Het
Zxdc A G 6: 90,347,542 (GRCm39) D301G probably damaging Het
Other mutations in Dact2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Dact2 APN 17 14,415,932 (GRCm39) missense probably damaging 0.98
R0597:Dact2 UTSW 17 14,417,303 (GRCm39) missense probably benign
R1657:Dact2 UTSW 17 14,418,252 (GRCm39) missense probably benign 0.03
R1717:Dact2 UTSW 17 14,418,175 (GRCm39) missense probably benign 0.11
R1734:Dact2 UTSW 17 14,416,901 (GRCm39) missense probably benign 0.00
R1883:Dact2 UTSW 17 14,418,085 (GRCm39) missense possibly damaging 0.81
R2238:Dact2 UTSW 17 14,417,312 (GRCm39) missense probably damaging 0.99
R2878:Dact2 UTSW 17 14,416,176 (GRCm39) missense probably damaging 1.00
R4290:Dact2 UTSW 17 14,416,833 (GRCm39) missense probably benign 0.00
R4291:Dact2 UTSW 17 14,416,833 (GRCm39) missense probably benign 0.00
R4902:Dact2 UTSW 17 14,416,991 (GRCm39) missense possibly damaging 0.91
R5029:Dact2 UTSW 17 14,416,114 (GRCm39) missense probably benign 0.00
R5084:Dact2 UTSW 17 14,418,214 (GRCm39) missense possibly damaging 0.94
R5837:Dact2 UTSW 17 14,416,515 (GRCm39) missense probably damaging 1.00
R5847:Dact2 UTSW 17 14,419,450 (GRCm39) missense probably damaging 0.97
R6048:Dact2 UTSW 17 14,417,567 (GRCm39) missense probably damaging 1.00
R6377:Dact2 UTSW 17 14,419,450 (GRCm39) missense probably damaging 0.97
R7013:Dact2 UTSW 17 14,423,796 (GRCm39) missense probably benign
R7268:Dact2 UTSW 17 14,416,797 (GRCm39) missense probably benign 0.01
R7425:Dact2 UTSW 17 14,416,593 (GRCm39) missense probably damaging 1.00
R8725:Dact2 UTSW 17 14,417,146 (GRCm39) nonsense probably null
R8727:Dact2 UTSW 17 14,417,146 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGTGACCCCAGACGACTC -3'
(R):5'- AGTCCAGCAGCAACGATTC -3'

Sequencing Primer
(F):5'- CTAAGCGCAATAGCAGGTTGATACC -3'
(R):5'- CAACGATTCAGAAGGGTGTTTCC -3'
Posted On 2016-09-01