Mutagenetix > Incidental Mutation

Incidental Mutation 'R5437:Rabgap1l'

428403

Institutional Source

Beutler Lab

Gene Symbol

Rabgap1l

Ensembl Gene

ENSMUSG00000026721

Gene Name

RAB GTPase activating protein 1-like

Synonyms

Hh1, 8430421H08Rik, 5830411O09Rik, 9630005B12Rik

MMRRC Submission

043002-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5437 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

160219174-160793211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 160722147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 324 (E324D)

Ref Sequence

ENSEMBL: ENSMUSP00000028049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028049] [ENSMUST00000195442]

AlphaFold

A6H6A9

Predicted Effect

probably damaging
Transcript: ENSMUST00000028049
AA Change: E324D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028049
Gene: ENSMUSG00000026721
AA Change: E324D

Domain	Start	End	E-Value	Type
low complexity region	113	124	N/A	INTRINSIC
PTB	127	260	4.47e-20	SMART
Pfam:DUF3694	290	421	8.1e-41	PFAM
low complexity region	483	496	N/A	INTRINSIC
TBC	535	747	5.13e-67	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193191

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195442
AA Change: E296D

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141666
Gene: ENSMUSG00000026721
AA Change: E296D

Domain	Start	End	E-Value	Type
low complexity region	85	96	N/A	INTRINSIC
PTB	99	232	4.47e-20	SMART
Pfam:DUF3694	262	394	1.4e-42	PFAM

Meta Mutation Damage Score

0.2048

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and overtly normal with no alterations in hematopoietic progenitor cell numbers or types. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Acaca	G	A	11: 84,346,820		probably null	Het
Acsm3	C	A	7: 119,778,497		probably benign	Het
Aoc1	C	A	6: 48,907,750	Q576K	probably benign	Het
Atp6v0a4	T	A	6: 38,076,733	N378I	probably damaging	Het
BC003331	T	G	1: 150,363,518	I385L	probably benign	Het
Cacna1i	A	T	15: 80,371,529	H871L	probably damaging	Het
Clic4	C	G	4: 135,217,246	R206P	probably damaging	Het
Commd9	G	A	2: 101,901,028	G186D	probably damaging	Het
Cpne9	C	T	6: 113,304,630		probably benign	Het
Crhr2	C	T	6: 55,100,733	V196I	probably damaging	Het
Dctn5	T	A	7: 122,133,329		probably benign	Het
Dhtkd1	C	T	2: 5,924,119	R247Q	probably benign	Het
Dmrta1	G	A	4: 89,691,756	G318R	possibly damaging	Het
Dpp6	T	A	5: 27,663,501	Y487*	probably null	Het
Eef1akmt3	A	T	10: 127,033,247	N119K	probably damaging	Het
Eloa	A	T	4: 136,012,885	L75Q	probably damaging	Het
Fat3	G	A	9: 16,085,308	T1202M	probably damaging	Het
Fcho2	A	G	13: 98,777,474	I205T	possibly damaging	Het
Fkbp10	A	C	11: 100,421,023	D174A	probably damaging	Het
Gcnt2	T	A	13: 40,861,176	F274L	probably damaging	Het
Gtf3c1	A	T	7: 125,667,368	C969S	probably damaging	Het
Hook3	T	C	8: 26,061,422	E130G	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Itsn1	T	A	16: 91,818,591		probably benign	Het
Kif13b	C	T	14: 64,806,114	R1788C	probably damaging	Het
Kif3a	C	T	11: 53,598,726	S135F	probably damaging	Het
Klf5	C	T	14: 99,301,459	R23*	probably null	Het
Lcn5	A	G	2: 25,658,011	I11V	probably benign	Het
Mpp7	A	T	18: 7,458,930		probably null	Het
Mroh5	T	C	15: 73,787,969	I338V	probably benign	Het
Mthfd2l	A	G	5: 90,948,898	N126S	possibly damaging	Het
Myo18b	G	T	5: 112,757,573	A2053E	possibly damaging	Het
Naip6	A	T	13: 100,303,304	C318*	probably null	Het
Ndufs7	C	T	10: 80,254,924	R116C	possibly damaging	Het
Olfr1378	T	C	11: 50,969,108	M30T	probably benign	Het
Pnkd	T	C	1: 74,349,737	V214A	possibly damaging	Het
Popdc2	T	G	16: 38,362,901	V82G	probably benign	Het
Prkdc	A	T	16: 15,769,875	L2541F	possibly damaging	Het
Ptpn9	A	T	9: 57,020,037	H66L	possibly damaging	Het
Pygm	T	A	19: 6,390,382	N397K	probably damaging	Het
Rnf6	G	A	5: 146,210,280	R643C	probably damaging	Het
Ryr2	C	T	13: 11,655,713	V3466M	probably damaging	Het
Scn7a	A	G	2: 66,676,346	Y1400H	probably damaging	Het
Sept10	T	A	10: 59,176,959	N279I	probably damaging	Het
Sh3rf2	A	T	18: 42,141,014	Y415F	probably benign	Het
Sorcs1	T	C	19: 50,252,602	T449A	probably benign	Het
Tcam1	C	T	11: 106,285,423	T325M	probably damaging	Het
Tctn1	A	G	5: 122,258,879	I147T	probably benign	Het
Tet1	G	T	10: 62,814,451	H30Q	probably benign	Het
Tmem109	A	G	19: 10,872,014	I159T	probably damaging	Het
Tmem40	C	T	6: 115,759,031		probably benign	Het
Tnfrsf21	C	T	17: 43,037,862	P122S	possibly damaging	Het
Uaca	A	G	9: 60,871,451	D1038G	probably benign	Het
Ubr2	C	G	17: 46,963,697	E852D	probably benign	Het
Ubr3	A	T	2: 69,944,390	N518I	probably damaging	Het
Unc80	T	G	1: 66,654,578	L2596R	possibly damaging	Het
Zcchc3	G	A	2: 152,414,732	P16S	probably benign	Het

Other mutations in Rabgap1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Rabgap1l	APN	1	160738969	missense	probably benign	0.02
IGL01309:Rabgap1l	APN	1	160700798	missense	probably benign	0.00
IGL01448:Rabgap1l	APN	1	160740745	splice site	probably benign
IGL01886:Rabgap1l	APN	1	160342042	missense	probably damaging	1.00
IGL02010:Rabgap1l	APN	1	160472071	missense	probably damaging	0.99
IGL02079:Rabgap1l	APN	1	160738970	missense	probably benign	0.00
IGL02800:Rabgap1l	APN	1	160472053	missense	possibly damaging	0.73
IGL03343:Rabgap1l	APN	1	160443283	missense	probably benign
IGL03388:Rabgap1l	APN	1	160733523	splice site	probably null
IGL03406:Rabgap1l	APN	1	160722169	missense	probably damaging	1.00
amerigo	UTSW	1	160724036	missense	probably damaging	1.00
hispaniola	UTSW	1	160645307	critical splice donor site	probably null
R0047:Rabgap1l	UTSW	1	160231789	splice site	probably benign
R0047:Rabgap1l	UTSW	1	160231789	splice site	probably benign
R0048:Rabgap1l	UTSW	1	160627369	splice site	probably benign
R0099:Rabgap1l	UTSW	1	160682116	missense	possibly damaging	0.89
R0201:Rabgap1l	UTSW	1	160453745	splice site	probably benign
R0432:Rabgap1l	UTSW	1	160722205	missense	probably benign	0.10
R1104:Rabgap1l	UTSW	1	160231875	splice site	probably benign
R1220:Rabgap1l	UTSW	1	160738909	missense	probably damaging	1.00
R1485:Rabgap1l	UTSW	1	160733680	missense	probably benign	0.06
R1569:Rabgap1l	UTSW	1	160702390	missense	probably benign	0.08
R1907:Rabgap1l	UTSW	1	160645310	missense	probably benign	0.07
R2128:Rabgap1l	UTSW	1	160738957	missense	probably benign	0.00
R2129:Rabgap1l	UTSW	1	160738957	missense	probably benign	0.00
R2177:Rabgap1l	UTSW	1	160724062	missense	possibly damaging	0.89
R4636:Rabgap1l	UTSW	1	160342090	splice site	probably null
R4722:Rabgap1l	UTSW	1	160342164	missense	possibly damaging	0.81
R4743:Rabgap1l	UTSW	1	160453783	missense	probably damaging	1.00
R4913:Rabgap1l	UTSW	1	160238541	missense	probably damaging	1.00
R4915:Rabgap1l	UTSW	1	160441842	missense	probably benign	0.01
R5035:Rabgap1l	UTSW	1	160724036	missense	probably damaging	1.00
R5087:Rabgap1l	UTSW	1	160722239	missense	probably damaging	1.00
R5507:Rabgap1l	UTSW	1	160351328	missense	possibly damaging	0.83
R5619:Rabgap1l	UTSW	1	160238572	missense	probably benign	0.00
R5691:Rabgap1l	UTSW	1	160735684	missense	probably damaging	1.00
R5837:Rabgap1l	UTSW	1	160307222	utr 3 prime	probably benign
R5881:Rabgap1l	UTSW	1	160342113	missense	probably damaging	1.00
R6045:Rabgap1l	UTSW	1	160645323	missense	probably benign	0.00
R6243:Rabgap1l	UTSW	1	160645307	critical splice donor site	probably null
R6294:Rabgap1l	UTSW	1	160231849	missense	probably benign	0.14
R6452:Rabgap1l	UTSW	1	160453761	missense	probably damaging	1.00
R6802:Rabgap1l	UTSW	1	160733680	missense	probably benign	0.06
R6945:Rabgap1l	UTSW	1	160682182	missense	probably benign	0.29
R7014:Rabgap1l	UTSW	1	160342072	missense	probably damaging	1.00
R7062:Rabgap1l	UTSW	1	160226650	missense	probably benign
R7089:Rabgap1l	UTSW	1	160724172	nonsense	probably null
R7170:Rabgap1l	UTSW	1	160645365	missense	probably damaging	1.00
R7172:Rabgap1l	UTSW	1	160733586	missense	probably benign	0.05
R7303:Rabgap1l	UTSW	1	160682097	missense	probably benign	0.01
R7357:Rabgap1l	UTSW	1	160342038	missense	probably damaging	1.00
R7466:Rabgap1l	UTSW	1	160226484	critical splice donor site	probably null
R7501:Rabgap1l	UTSW	1	160700788	missense	probably damaging	0.98
R7565:Rabgap1l	UTSW	1	160251417	missense
R7582:Rabgap1l	UTSW	1	160682084	missense	probably benign
R7740:Rabgap1l	UTSW	1	160682103	missense	probably benign	0.01
R7978:Rabgap1l	UTSW	1	160251268	missense
R7993:Rabgap1l	UTSW	1	160700854	missense	probably damaging	1.00
R8116:Rabgap1l	UTSW	1	160702442	missense	probably benign	0.22
R8672:Rabgap1l	UTSW	1	160443276	missense	probably damaging	1.00
R8986:Rabgap1l	UTSW	1	160257535	missense	probably damaging	0.99
R9010:Rabgap1l	UTSW	1	160700873	missense	possibly damaging	0.80
R9286:Rabgap1l	UTSW	1	160224248	nonsense	probably null
Z1177:Rabgap1l	UTSW	1	160739073	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CTGAATCAGTAGGAGGAGATCTGTA -3'
(R):5'- CTGTATGAAGTGAGATTCAATATGTCT -3'

Sequencing Primer
(F):5'- TCAGTAGGAGGAGATCTGTAAGGGC -3'
(R):5'- TCTGTGAGTTCAAGGCCAAC -3'

Posted On

2016-09-01