Mutagenetix > Incidental Mutation

Incidental Mutation 'R5437:Ubr3'

428407

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

043002-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5437 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69944390 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 518 (N518I)

Ref Sequence

ENSEMBL: ENSMUSP00000107870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

AlphaFold

Q5U430

Predicted Effect

probably damaging
Transcript: ENSMUST00000055758
AA Change: N519I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: N519I

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112251
AA Change: N518I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: N518I

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142563

Meta Mutation Damage Score

0.4968

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Acaca	G	A	11: 84,346,820		probably null	Het
Acsm3	C	A	7: 119,778,497		probably benign	Het
Aoc1	C	A	6: 48,907,750	Q576K	probably benign	Het
Atp6v0a4	T	A	6: 38,076,733	N378I	probably damaging	Het
BC003331	T	G	1: 150,363,518	I385L	probably benign	Het
Cacna1i	A	T	15: 80,371,529	H871L	probably damaging	Het
Clic4	C	G	4: 135,217,246	R206P	probably damaging	Het
Commd9	G	A	2: 101,901,028	G186D	probably damaging	Het
Cpne9	C	T	6: 113,304,630		probably benign	Het
Crhr2	C	T	6: 55,100,733	V196I	probably damaging	Het
Dctn5	T	A	7: 122,133,329		probably benign	Het
Dhtkd1	C	T	2: 5,924,119	R247Q	probably benign	Het
Dmrta1	G	A	4: 89,691,756	G318R	possibly damaging	Het
Dpp6	T	A	5: 27,663,501	Y487*	probably null	Het
Eef1akmt3	A	T	10: 127,033,247	N119K	probably damaging	Het
Eloa	A	T	4: 136,012,885	L75Q	probably damaging	Het
Fat3	G	A	9: 16,085,308	T1202M	probably damaging	Het
Fcho2	A	G	13: 98,777,474	I205T	possibly damaging	Het
Fkbp10	A	C	11: 100,421,023	D174A	probably damaging	Het
Gcnt2	T	A	13: 40,861,176	F274L	probably damaging	Het
Gtf3c1	A	T	7: 125,667,368	C969S	probably damaging	Het
Hook3	T	C	8: 26,061,422	E130G	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Itsn1	T	A	16: 91,818,591		probably benign	Het
Kif13b	C	T	14: 64,806,114	R1788C	probably damaging	Het
Kif3a	C	T	11: 53,598,726	S135F	probably damaging	Het
Klf5	C	T	14: 99,301,459	R23*	probably null	Het
Lcn5	A	G	2: 25,658,011	I11V	probably benign	Het
Mpp7	A	T	18: 7,458,930		probably null	Het
Mroh5	T	C	15: 73,787,969	I338V	probably benign	Het
Mthfd2l	A	G	5: 90,948,898	N126S	possibly damaging	Het
Myo18b	G	T	5: 112,757,573	A2053E	possibly damaging	Het
Naip6	A	T	13: 100,303,304	C318*	probably null	Het
Ndufs7	C	T	10: 80,254,924	R116C	possibly damaging	Het
Olfr1378	T	C	11: 50,969,108	M30T	probably benign	Het
Pnkd	T	C	1: 74,349,737	V214A	possibly damaging	Het
Popdc2	T	G	16: 38,362,901	V82G	probably benign	Het
Prkdc	A	T	16: 15,769,875	L2541F	possibly damaging	Het
Ptpn9	A	T	9: 57,020,037	H66L	possibly damaging	Het
Pygm	T	A	19: 6,390,382	N397K	probably damaging	Het
Rabgap1l	T	A	1: 160,722,147	E324D	probably damaging	Het
Rnf6	G	A	5: 146,210,280	R643C	probably damaging	Het
Ryr2	C	T	13: 11,655,713	V3466M	probably damaging	Het
Scn7a	A	G	2: 66,676,346	Y1400H	probably damaging	Het
Sept10	T	A	10: 59,176,959	N279I	probably damaging	Het
Sh3rf2	A	T	18: 42,141,014	Y415F	probably benign	Het
Sorcs1	T	C	19: 50,252,602	T449A	probably benign	Het
Tcam1	C	T	11: 106,285,423	T325M	probably damaging	Het
Tctn1	A	G	5: 122,258,879	I147T	probably benign	Het
Tet1	G	T	10: 62,814,451	H30Q	probably benign	Het
Tmem109	A	G	19: 10,872,014	I159T	probably damaging	Het
Tmem40	C	T	6: 115,759,031		probably benign	Het
Tnfrsf21	C	T	17: 43,037,862	P122S	possibly damaging	Het
Uaca	A	G	9: 60,871,451	D1038G	probably benign	Het
Ubr2	C	G	17: 46,963,697	E852D	probably benign	Het
Unc80	T	G	1: 66,654,578	L2596R	possibly damaging	Het
Zcchc3	G	A	2: 152,414,732	P16S	probably benign	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R7991:Ubr3	UTSW	2	69952856	missense	probably damaging	1.00
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8136:Ubr3	UTSW	2	70021179	missense	probably damaging	1.00
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
R8675:Ubr3	UTSW	2	70020521	missense	probably damaging	1.00
R8834:Ubr3	UTSW	2	70003441	missense	probably benign
R8975:Ubr3	UTSW	2	69922307	missense	probably damaging	1.00
R9060:Ubr3	UTSW	2	70009145	nonsense	probably null
R9153:Ubr3	UTSW	2	69965478	missense
R9234:Ubr3	UTSW	2	69897646	missense	probably benign
R9293:Ubr3	UTSW	2	69897425	missense	probably benign	0.02
R9312:Ubr3	UTSW	2	69954333	missense	probably damaging	1.00
R9710:Ubr3	UTSW	2	69897613	missense	possibly damaging	0.94
R9762:Ubr3	UTSW	2	70009153	missense	probably benign	0.00
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAACAGTATGTGCAGCCATACAG -3'
(R):5'- AGGATGAGACACCTGATTTATAACC -3'

Sequencing Primer
(F):5'- GGATCCAAGTGTTTCTGATTCTAAG -3'
(R):5'- GTAATTCCTACCTTGAAAGAAAG -3'

Posted On

2016-09-01