Mutagenetix > Incidental Mutation

Incidental Mutation 'R5437:Dpp6'

428413

Institutional Source

Beutler Lab

Gene Symbol

Dpp6

Ensembl Gene

ENSMUSG00000061576

Gene Name

dipeptidylpeptidase 6

Synonyms

Rw, LOC384168, Peplb, Dpp-6, B930011P16Rik, In(5)6H-p

MMRRC Submission

043002-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R5437 (G1)

Quality Score

221

Status

Validated

Chromosome

Chromosomal Location

26817203-27727505 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 27663501 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 487 (Y487*)

Ref Sequence

ENSEMBL: ENSMUSP00000113441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]

AlphaFold

Q9Z218

Predicted Effect

probably null
Transcript: ENSMUST00000071500
AA Change: Y432*

SMART Domains

Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576
AA Change: Y432*

Domain	Start	End	E-Value	Type
transmembrane domain	35	57	N/A	INTRINSIC
Pfam:DPPIV_N	134	500	7.2e-114	PFAM
Pfam:PD40	365	402	1.1e-5	PFAM
Pfam:Peptidase_S9	579	789	2.9e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000101471
AA Change: Y431*

SMART Domains

Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576
AA Change: Y431*

Domain	Start	End	E-Value	Type
transmembrane domain	34	56	N/A	INTRINSIC
Pfam:DPPIV_N	133	499	2.6e-114	PFAM
Pfam:PD40	364	401	9.3e-6	PFAM
Pfam:Peptidase_S9	578	788	1.9e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000120555
AA Change: Y429*

SMART Domains

Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576
AA Change: Y429*

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
Pfam:DPPIV_N	131	497	2.6e-114	PFAM
Pfam:PD40	362	399	9.2e-6	PFAM
Pfam:Peptidase_S9	576	786	1.9e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000122171
AA Change: Y487*

SMART Domains

Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576
AA Change: Y487*

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC
transmembrane domain	90	112	N/A	INTRINSIC
Pfam:DPPIV_N	189	555	6.4e-113	PFAM
Pfam:PD40	425	457	1.1e-4	PFAM
Pfam:Peptidase_S9	634	844	4.3e-40	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134175

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Acaca	G	A	11: 84,346,820		probably null	Het
Acsm3	C	A	7: 119,778,497		probably benign	Het
Aoc1	C	A	6: 48,907,750	Q576K	probably benign	Het
Atp6v0a4	T	A	6: 38,076,733	N378I	probably damaging	Het
BC003331	T	G	1: 150,363,518	I385L	probably benign	Het
Cacna1i	A	T	15: 80,371,529	H871L	probably damaging	Het
Clic4	C	G	4: 135,217,246	R206P	probably damaging	Het
Commd9	G	A	2: 101,901,028	G186D	probably damaging	Het
Cpne9	C	T	6: 113,304,630		probably benign	Het
Crhr2	C	T	6: 55,100,733	V196I	probably damaging	Het
Dctn5	T	A	7: 122,133,329		probably benign	Het
Dhtkd1	C	T	2: 5,924,119	R247Q	probably benign	Het
Dmrta1	G	A	4: 89,691,756	G318R	possibly damaging	Het
Eef1akmt3	A	T	10: 127,033,247	N119K	probably damaging	Het
Eloa	A	T	4: 136,012,885	L75Q	probably damaging	Het
Fat3	G	A	9: 16,085,308	T1202M	probably damaging	Het
Fcho2	A	G	13: 98,777,474	I205T	possibly damaging	Het
Fkbp10	A	C	11: 100,421,023	D174A	probably damaging	Het
Gcnt2	T	A	13: 40,861,176	F274L	probably damaging	Het
Gtf3c1	A	T	7: 125,667,368	C969S	probably damaging	Het
Hook3	T	C	8: 26,061,422	E130G	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Itsn1	T	A	16: 91,818,591		probably benign	Het
Kif13b	C	T	14: 64,806,114	R1788C	probably damaging	Het
Kif3a	C	T	11: 53,598,726	S135F	probably damaging	Het
Klf5	C	T	14: 99,301,459	R23*	probably null	Het
Lcn5	A	G	2: 25,658,011	I11V	probably benign	Het
Mpp7	A	T	18: 7,458,930		probably null	Het
Mroh5	T	C	15: 73,787,969	I338V	probably benign	Het
Mthfd2l	A	G	5: 90,948,898	N126S	possibly damaging	Het
Myo18b	G	T	5: 112,757,573	A2053E	possibly damaging	Het
Naip6	A	T	13: 100,303,304	C318*	probably null	Het
Ndufs7	C	T	10: 80,254,924	R116C	possibly damaging	Het
Olfr1378	T	C	11: 50,969,108	M30T	probably benign	Het
Pnkd	T	C	1: 74,349,737	V214A	possibly damaging	Het
Popdc2	T	G	16: 38,362,901	V82G	probably benign	Het
Prkdc	A	T	16: 15,769,875	L2541F	possibly damaging	Het
Ptpn9	A	T	9: 57,020,037	H66L	possibly damaging	Het
Pygm	T	A	19: 6,390,382	N397K	probably damaging	Het
Rabgap1l	T	A	1: 160,722,147	E324D	probably damaging	Het
Rnf6	G	A	5: 146,210,280	R643C	probably damaging	Het
Ryr2	C	T	13: 11,655,713	V3466M	probably damaging	Het
Scn7a	A	G	2: 66,676,346	Y1400H	probably damaging	Het
Sept10	T	A	10: 59,176,959	N279I	probably damaging	Het
Sh3rf2	A	T	18: 42,141,014	Y415F	probably benign	Het
Sorcs1	T	C	19: 50,252,602	T449A	probably benign	Het
Tcam1	C	T	11: 106,285,423	T325M	probably damaging	Het
Tctn1	A	G	5: 122,258,879	I147T	probably benign	Het
Tet1	G	T	10: 62,814,451	H30Q	probably benign	Het
Tmem109	A	G	19: 10,872,014	I159T	probably damaging	Het
Tmem40	C	T	6: 115,759,031		probably benign	Het
Tnfrsf21	C	T	17: 43,037,862	P122S	possibly damaging	Het
Uaca	A	G	9: 60,871,451	D1038G	probably benign	Het
Ubr2	C	G	17: 46,963,697	E852D	probably benign	Het
Ubr3	A	T	2: 69,944,390	N518I	probably damaging	Het
Unc80	T	G	1: 66,654,578	L2596R	possibly damaging	Het
Zcchc3	G	A	2: 152,414,732	P16S	probably benign	Het

Other mutations in Dpp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Dpp6	APN	5	27723443	missense	probably damaging	1.00
IGL01137:Dpp6	APN	5	27714488	missense	probably damaging	1.00
IGL01386:Dpp6	APN	5	27664762	critical splice donor site	probably null
IGL01409:Dpp6	APN	5	27557601	missense	probably damaging	1.00
IGL01721:Dpp6	APN	5	27631520	missense	probably damaging	1.00
IGL02149:Dpp6	APN	5	27538024	missense	probably benign	0.00
IGL02174:Dpp6	APN	5	27721087	nonsense	probably null
IGL02176:Dpp6	APN	5	27723577	missense	probably damaging	0.98
IGL02326:Dpp6	APN	5	27664757	missense	probably damaging	1.00
IGL02336:Dpp6	APN	5	27469411	missense	probably benign	0.04
IGL02339:Dpp6	APN	5	27652230	missense	probably damaging	0.97
IGL02402:Dpp6	APN	5	27634543	missense	probably damaging	1.00
IGL02884:Dpp6	APN	5	27634556	missense	possibly damaging	0.88
IGL02885:Dpp6	APN	5	27718473	missense	probably damaging	1.00
IGL02938:Dpp6	APN	5	27723367	splice site	probably benign
IGL03083:Dpp6	APN	5	27709550	critical splice donor site	probably null
I0000:Dpp6	UTSW	5	27398922	missense	probably benign	0.02
IGL03052:Dpp6	UTSW	5	27709508	missense	probably benign	0.03
PIT4431001:Dpp6	UTSW	5	27631498	missense	probably benign	0.03
R0060:Dpp6	UTSW	5	27598819	missense	probably damaging	1.00
R0360:Dpp6	UTSW	5	27652269	missense	probably damaging	1.00
R0486:Dpp6	UTSW	5	27661642	missense	probably benign	0.39
R0501:Dpp6	UTSW	5	27725606	missense	probably damaging	1.00
R1028:Dpp6	UTSW	5	27666427	missense	probably benign	0.01
R1164:Dpp6	UTSW	5	27721105	missense	probably benign	0.02
R1177:Dpp6	UTSW	5	27663473	missense	possibly damaging	0.94
R1993:Dpp6	UTSW	5	27399006	missense	probably benign	0.00
R2024:Dpp6	UTSW	5	27709459	missense	possibly damaging	0.67
R2100:Dpp6	UTSW	5	27664744	missense	probably damaging	0.96
R2329:Dpp6	UTSW	5	27451288	splice site	probably null
R3619:Dpp6	UTSW	5	27721120	missense	possibly damaging	0.74
R3871:Dpp6	UTSW	5	27469465	missense	probably benign	0.03
R3872:Dpp6	UTSW	5	27721058	missense	probably damaging	1.00
R4114:Dpp6	UTSW	5	27469487	critical splice donor site	probably null
R4403:Dpp6	UTSW	5	27718462	missense	probably damaging	1.00
R4599:Dpp6	UTSW	5	27634548	missense	probably damaging	1.00
R4736:Dpp6	UTSW	5	27712659	missense	probably damaging	1.00
R4929:Dpp6	UTSW	5	27049787	missense	probably benign	0.25
R4967:Dpp6	UTSW	5	27666511	missense	probably damaging	1.00
R5162:Dpp6	UTSW	5	27399015	unclassified	probably benign
R5270:Dpp6	UTSW	5	27634534	missense	probably damaging	0.98
R5334:Dpp6	UTSW	5	27709540	missense	probably benign	0.30
R5663:Dpp6	UTSW	5	27049622	missense	possibly damaging	0.84
R6023:Dpp6	UTSW	5	27723547	missense	probably damaging	0.96
R6244:Dpp6	UTSW	5	27049628	missense	probably damaging	0.99
R6312:Dpp6	UTSW	5	27725671	missense	possibly damaging	0.84
R6442:Dpp6	UTSW	5	27718509	critical splice donor site	probably null
R6942:Dpp6	UTSW	5	27469459	missense	possibly damaging	0.79
R6956:Dpp6	UTSW	5	27598821	missense	probably damaging	1.00
R7210:Dpp6	UTSW	5	27598803	missense	probably damaging	0.99
R7342:Dpp6	UTSW	5	27714554	missense	probably benign
R7702:Dpp6	UTSW	5	27652276	missense	probably benign	0.00
R7727:Dpp6	UTSW	5	27451244	missense	probably benign	0.30
R7899:Dpp6	UTSW	5	27721079	missense	probably benign	0.03
R7966:Dpp6	UTSW	5	27723372	missense	probably benign	0.06
R8015:Dpp6	UTSW	5	26817810	start gained	probably benign
R8084:Dpp6	UTSW	5	27631399	missense	probably benign	0.32
R8178:Dpp6	UTSW	5	27598817	missense	probably damaging	1.00
R8384:Dpp6	UTSW	5	27718474	missense	probably benign	0.18
R8816:Dpp6	UTSW	5	27725713	missense	probably benign	0.07
R8936:Dpp6	UTSW	5	27721142	missense	probably damaging	1.00
R9090:Dpp6	UTSW	5	27598834	nonsense	probably null
R9164:Dpp6	UTSW	5	27451288	splice site	probably null
R9271:Dpp6	UTSW	5	27598834	nonsense	probably null
R9310:Dpp6	UTSW	5	27631441	missense	probably damaging	0.97
R9310:Dpp6	UTSW	5	27725644	missense	probably benign	0.11
R9320:Dpp6	UTSW	5	27663523	critical splice donor site	probably null
R9667:Dpp6	UTSW	5	27725606	missense	probably damaging	1.00
R9761:Dpp6	UTSW	5	27664745	missense	probably benign	0.38
Z1176:Dpp6	UTSW	5	27398998	missense	probably damaging	1.00
Z1177:Dpp6	UTSW	5	27712642	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCTACTGGCAACACTCAGAG -3'
(R):5'- GAGTCAGGAGCTCACAATGG -3'

Sequencing Primer
(F):5'- CACTCAGAGGCCATTGCAGAG -3'
(R):5'- AGCTCACAATGGTAAGTGCC -3'

Posted On

2016-09-01