Incidental Mutation 'R5437:Hook3'
ID 428425
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Name hook microtubule tethering protein 3
Synonyms E330005F07Rik, 5830454D03Rik
MMRRC Submission 043002-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5437 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 26511449-26609252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26551450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 130 (E130G)
Ref Sequence ENSEMBL: ENSMUSP00000115008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
AlphaFold Q8BUK6
Predicted Effect probably benign
Transcript: ENSMUST00000037182
AA Change: E449G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: E449G

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
AA Change: E130G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234
AA Change: E130G

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210389
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,210,622 (GRCm39) Q186* probably null Het
Acaca G A 11: 84,237,646 (GRCm39) probably null Het
Acsm3 C A 7: 119,377,720 (GRCm39) probably benign Het
Aoc1 C A 6: 48,884,684 (GRCm39) Q576K probably benign Het
Atp6v0a4 T A 6: 38,053,668 (GRCm39) N378I probably damaging Het
Cacna1i A T 15: 80,255,730 (GRCm39) H871L probably damaging Het
Clic4 C G 4: 134,944,557 (GRCm39) R206P probably damaging Het
Commd9 G A 2: 101,731,373 (GRCm39) G186D probably damaging Het
Cpne9 C T 6: 113,281,591 (GRCm39) probably benign Het
Crhr2 C T 6: 55,077,718 (GRCm39) V196I probably damaging Het
Dctn5 T A 7: 121,732,552 (GRCm39) probably benign Het
Dhtkd1 C T 2: 5,928,930 (GRCm39) R247Q probably benign Het
Dmrta1 G A 4: 89,579,993 (GRCm39) G318R possibly damaging Het
Dpp6 T A 5: 27,868,499 (GRCm39) Y487* probably null Het
Eef1akmt3 A T 10: 126,869,116 (GRCm39) N119K probably damaging Het
Eloa A T 4: 135,740,196 (GRCm39) L75Q probably damaging Het
Fat3 G A 9: 15,996,604 (GRCm39) T1202M probably damaging Het
Fcho2 A G 13: 98,913,982 (GRCm39) I205T possibly damaging Het
Fkbp10 A C 11: 100,311,849 (GRCm39) D174A probably damaging Het
Gcnt2 T A 13: 41,014,652 (GRCm39) F274L probably damaging Het
Gtf3c1 A T 7: 125,266,540 (GRCm39) C969S probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Itsn1 T A 16: 91,615,479 (GRCm39) probably benign Het
Kif13b C T 14: 65,043,563 (GRCm39) R1788C probably damaging Het
Kif3a C T 11: 53,489,553 (GRCm39) S135F probably damaging Het
Klf5 C T 14: 99,538,895 (GRCm39) R23* probably null Het
Lcn5 A G 2: 25,548,023 (GRCm39) I11V probably benign Het
Mpp7 A T 18: 7,458,930 (GRCm39) probably null Het
Mroh5 T C 15: 73,659,818 (GRCm39) I338V probably benign Het
Mthfd2l A G 5: 91,096,757 (GRCm39) N126S possibly damaging Het
Myo18b G T 5: 112,905,439 (GRCm39) A2053E possibly damaging Het
Naip6 A T 13: 100,439,812 (GRCm39) C318* probably null Het
Ndufs7 C T 10: 80,090,758 (GRCm39) R116C possibly damaging Het
Odr4 T G 1: 150,239,269 (GRCm39) I385L probably benign Het
Or1ad6 T C 11: 50,859,935 (GRCm39) M30T probably benign Het
Pnkd T C 1: 74,388,896 (GRCm39) V214A possibly damaging Het
Popdc2 T G 16: 38,183,263 (GRCm39) V82G probably benign Het
Prkdc A T 16: 15,587,739 (GRCm39) L2541F possibly damaging Het
Ptpn9 A T 9: 56,927,321 (GRCm39) H66L possibly damaging Het
Pygm T A 19: 6,440,412 (GRCm39) N397K probably damaging Het
Rabgap1l T A 1: 160,549,717 (GRCm39) E324D probably damaging Het
Rnf6 G A 5: 146,147,090 (GRCm39) R643C probably damaging Het
Ryr2 C T 13: 11,670,599 (GRCm39) V3466M probably damaging Het
Scn7a A G 2: 66,506,690 (GRCm39) Y1400H probably damaging Het
Septin10 T A 10: 59,012,781 (GRCm39) N279I probably damaging Het
Sh3rf2 A T 18: 42,274,079 (GRCm39) Y415F probably benign Het
Sorcs1 T C 19: 50,241,040 (GRCm39) T449A probably benign Het
Tcam1 C T 11: 106,176,249 (GRCm39) T325M probably damaging Het
Tctn1 A G 5: 122,396,942 (GRCm39) I147T probably benign Het
Tet1 G T 10: 62,650,230 (GRCm39) H30Q probably benign Het
Tmem109 A G 19: 10,849,378 (GRCm39) I159T probably damaging Het
Tmem40 C T 6: 115,735,992 (GRCm39) probably benign Het
Tnfrsf21 C T 17: 43,348,753 (GRCm39) P122S possibly damaging Het
Uaca A G 9: 60,778,733 (GRCm39) D1038G probably benign Het
Ubr2 C G 17: 47,274,623 (GRCm39) E852D probably benign Het
Ubr3 A T 2: 69,774,734 (GRCm39) N518I probably damaging Het
Unc80 T G 1: 66,693,737 (GRCm39) L2596R possibly damaging Het
Zcchc3 G A 2: 152,256,652 (GRCm39) P16S probably benign Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26,549,278 (GRCm39) missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26,538,326 (GRCm39) missense probably damaging 1.00
IGL01145:Hook3 APN 8 26,549,372 (GRCm39) missense probably benign 0.00
IGL01514:Hook3 APN 8 26,578,217 (GRCm39) missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26,560,187 (GRCm39) missense probably benign 0.00
IGL01832:Hook3 APN 8 26,562,393 (GRCm39) missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26,529,760 (GRCm39) missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26,578,083 (GRCm39) splice site probably benign
IGL01948:Hook3 APN 8 26,549,340 (GRCm39) missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26,560,293 (GRCm39) missense probably damaging 0.99
IGL02675:Hook3 APN 8 26,551,462 (GRCm39) missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26,585,782 (GRCm39) splice site probably benign
Rufio UTSW 8 26,524,968 (GRCm39) nonsense probably null
R0384:Hook3 UTSW 8 26,534,263 (GRCm39) splice site probably null
R0600:Hook3 UTSW 8 26,609,014 (GRCm39) missense probably benign
R1037:Hook3 UTSW 8 26,562,378 (GRCm39) missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26,528,134 (GRCm39) missense probably damaging 0.98
R1563:Hook3 UTSW 8 26,600,780 (GRCm39) missense probably benign 0.06
R1767:Hook3 UTSW 8 26,561,084 (GRCm39) critical splice donor site probably null
R1806:Hook3 UTSW 8 26,558,687 (GRCm39) missense probably damaging 1.00
R2025:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2026:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2027:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2091:Hook3 UTSW 8 26,549,422 (GRCm39) splice site probably benign
R2153:Hook3 UTSW 8 26,560,225 (GRCm39) missense probably damaging 1.00
R2184:Hook3 UTSW 8 26,609,011 (GRCm39) missense probably benign 0.00
R4586:Hook3 UTSW 8 26,522,039 (GRCm39) missense probably damaging 0.98
R4863:Hook3 UTSW 8 26,528,057 (GRCm39) missense probably damaging 1.00
R4971:Hook3 UTSW 8 26,572,607 (GRCm39) missense probably benign 0.22
R5023:Hook3 UTSW 8 26,522,047 (GRCm39) frame shift probably null
R5026:Hook3 UTSW 8 26,600,785 (GRCm39) missense probably damaging 0.98
R5068:Hook3 UTSW 8 26,585,785 (GRCm39) critical splice donor site probably null
R5253:Hook3 UTSW 8 26,562,319 (GRCm39) missense probably benign
R5383:Hook3 UTSW 8 26,609,017 (GRCm39) missense probably benign 0.01
R5528:Hook3 UTSW 8 26,562,321 (GRCm39) missense probably damaging 1.00
R5551:Hook3 UTSW 8 26,558,639 (GRCm39) missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26,534,355 (GRCm39) intron probably benign
R5907:Hook3 UTSW 8 26,534,306 (GRCm39) intron probably benign
R6082:Hook3 UTSW 8 26,600,813 (GRCm39) missense probably benign 0.00
R6124:Hook3 UTSW 8 26,549,300 (GRCm39) missense probably benign 0.20
R6301:Hook3 UTSW 8 26,524,968 (GRCm39) nonsense probably null
R6314:Hook3 UTSW 8 26,578,136 (GRCm39) missense probably benign
R6448:Hook3 UTSW 8 26,583,692 (GRCm39) missense probably benign 0.02
R6810:Hook3 UTSW 8 26,522,450 (GRCm39) splice site probably null
R7168:Hook3 UTSW 8 26,561,114 (GRCm39) missense probably benign 0.02
R7856:Hook3 UTSW 8 26,525,249 (GRCm39) missense probably damaging 1.00
R7988:Hook3 UTSW 8 26,563,675 (GRCm39) missense probably benign 0.02
R8079:Hook3 UTSW 8 26,578,086 (GRCm39) critical splice donor site probably null
R9121:Hook3 UTSW 8 26,525,195 (GRCm39) missense probably damaging 1.00
R9223:Hook3 UTSW 8 26,522,552 (GRCm39) missense
R9244:Hook3 UTSW 8 26,561,084 (GRCm39) critical splice donor site probably null
R9246:Hook3 UTSW 8 26,562,319 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAAGACTGTCTTACCCAAGTG -3'
(R):5'- TGCCTAGTATCCACAGAGCC -3'

Sequencing Primer
(F):5'- AGTTCTCCAGTCAAGTTTAAAAAGC -3'
(R):5'- AGTATCCACAGAGCCTGGTTC -3'
Posted On 2016-09-01