Incidental Mutation 'R5437:Cacna1i'
ID 428447
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 043002-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5437 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80255730 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 871 (H871L)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably damaging
Transcript: ENSMUST00000160424
AA Change: H871L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: H871L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162155
AA Change: H871L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: H871L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Meta Mutation Damage Score 0.1080 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,210,622 (GRCm39) Q186* probably null Het
Acaca G A 11: 84,237,646 (GRCm39) probably null Het
Acsm3 C A 7: 119,377,720 (GRCm39) probably benign Het
Aoc1 C A 6: 48,884,684 (GRCm39) Q576K probably benign Het
Atp6v0a4 T A 6: 38,053,668 (GRCm39) N378I probably damaging Het
Clic4 C G 4: 134,944,557 (GRCm39) R206P probably damaging Het
Commd9 G A 2: 101,731,373 (GRCm39) G186D probably damaging Het
Cpne9 C T 6: 113,281,591 (GRCm39) probably benign Het
Crhr2 C T 6: 55,077,718 (GRCm39) V196I probably damaging Het
Dctn5 T A 7: 121,732,552 (GRCm39) probably benign Het
Dhtkd1 C T 2: 5,928,930 (GRCm39) R247Q probably benign Het
Dmrta1 G A 4: 89,579,993 (GRCm39) G318R possibly damaging Het
Dpp6 T A 5: 27,868,499 (GRCm39) Y487* probably null Het
Eef1akmt3 A T 10: 126,869,116 (GRCm39) N119K probably damaging Het
Eloa A T 4: 135,740,196 (GRCm39) L75Q probably damaging Het
Fat3 G A 9: 15,996,604 (GRCm39) T1202M probably damaging Het
Fcho2 A G 13: 98,913,982 (GRCm39) I205T possibly damaging Het
Fkbp10 A C 11: 100,311,849 (GRCm39) D174A probably damaging Het
Gcnt2 T A 13: 41,014,652 (GRCm39) F274L probably damaging Het
Gtf3c1 A T 7: 125,266,540 (GRCm39) C969S probably damaging Het
Hook3 T C 8: 26,551,450 (GRCm39) E130G probably benign Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Itsn1 T A 16: 91,615,479 (GRCm39) probably benign Het
Kif13b C T 14: 65,043,563 (GRCm39) R1788C probably damaging Het
Kif3a C T 11: 53,489,553 (GRCm39) S135F probably damaging Het
Klf5 C T 14: 99,538,895 (GRCm39) R23* probably null Het
Lcn5 A G 2: 25,548,023 (GRCm39) I11V probably benign Het
Mpp7 A T 18: 7,458,930 (GRCm39) probably null Het
Mroh5 T C 15: 73,659,818 (GRCm39) I338V probably benign Het
Mthfd2l A G 5: 91,096,757 (GRCm39) N126S possibly damaging Het
Myo18b G T 5: 112,905,439 (GRCm39) A2053E possibly damaging Het
Naip6 A T 13: 100,439,812 (GRCm39) C318* probably null Het
Ndufs7 C T 10: 80,090,758 (GRCm39) R116C possibly damaging Het
Odr4 T G 1: 150,239,269 (GRCm39) I385L probably benign Het
Or1ad6 T C 11: 50,859,935 (GRCm39) M30T probably benign Het
Pnkd T C 1: 74,388,896 (GRCm39) V214A possibly damaging Het
Popdc2 T G 16: 38,183,263 (GRCm39) V82G probably benign Het
Prkdc A T 16: 15,587,739 (GRCm39) L2541F possibly damaging Het
Ptpn9 A T 9: 56,927,321 (GRCm39) H66L possibly damaging Het
Pygm T A 19: 6,440,412 (GRCm39) N397K probably damaging Het
Rabgap1l T A 1: 160,549,717 (GRCm39) E324D probably damaging Het
Rnf6 G A 5: 146,147,090 (GRCm39) R643C probably damaging Het
Ryr2 C T 13: 11,670,599 (GRCm39) V3466M probably damaging Het
Scn7a A G 2: 66,506,690 (GRCm39) Y1400H probably damaging Het
Septin10 T A 10: 59,012,781 (GRCm39) N279I probably damaging Het
Sh3rf2 A T 18: 42,274,079 (GRCm39) Y415F probably benign Het
Sorcs1 T C 19: 50,241,040 (GRCm39) T449A probably benign Het
Tcam1 C T 11: 106,176,249 (GRCm39) T325M probably damaging Het
Tctn1 A G 5: 122,396,942 (GRCm39) I147T probably benign Het
Tet1 G T 10: 62,650,230 (GRCm39) H30Q probably benign Het
Tmem109 A G 19: 10,849,378 (GRCm39) I159T probably damaging Het
Tmem40 C T 6: 115,735,992 (GRCm39) probably benign Het
Tnfrsf21 C T 17: 43,348,753 (GRCm39) P122S possibly damaging Het
Uaca A G 9: 60,778,733 (GRCm39) D1038G probably benign Het
Ubr2 C G 17: 47,274,623 (GRCm39) E852D probably benign Het
Ubr3 A T 2: 69,774,734 (GRCm39) N518I probably damaging Het
Unc80 T G 1: 66,693,737 (GRCm39) L2596R possibly damaging Het
Zcchc3 G A 2: 152,256,652 (GRCm39) P16S probably benign Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCTGGTGGAGAACATCACAC -3'
(R):5'- TGCCACAGTCTTTCAGTGCC -3'

Sequencing Primer
(F):5'- TGGAGAACATCACACCAGAAAAGTTC -3'
(R):5'- GCGAGCATCCATCACAGG -3'
Posted On 2016-09-01