Mutagenetix > Incidental Mutations

Incidental Mutation 'R5437:Tnfrsf21'

428450

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf21

Ensembl Gene

ENSMUSG00000023915

Gene Name

tumor necrosis factor receptor superfamily, member 21

Synonyms

DR6, TR7, Death receptor 6

MMRRC Submission

043002-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R5437 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43016555-43089188 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43037862 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 122 (P122S)

Ref Sequence

ENSEMBL: ENSMUSP00000024708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024708]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024708
AA Change: P122S

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: P122S

Domain	Start	End	E-Value	Type
TNFR	50	88	1.58e1	SMART
TNFR	91	131	3.42e-3	SMART
TNFR	133	168	9.31e-5	SMART
TNFR	171	211	1.1e-1	SMART
transmembrane domain	351	370	N/A	INTRINSIC
DEATH	393	498	1.41e-22	SMART
low complexity region	511	526	N/A	INTRINSIC
low complexity region	562	575	N/A	INTRINSIC
PDB:2DBH\|A	576	655	5e-48	PDB

Meta Mutation Damage Score

0.0611

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Acaca	G	A	11: 84,346,820		probably null	Het
Acsm3	C	A	7: 119,778,497		probably benign	Het
Aoc1	C	A	6: 48,907,750	Q576K	probably benign	Het
Atp6v0a4	T	A	6: 38,076,733	N378I	probably damaging	Het
BC003331	T	G	1: 150,363,518	I385L	probably benign	Het
Cacna1i	A	T	15: 80,371,529	H871L	probably damaging	Het
Clic4	C	G	4: 135,217,246	R206P	probably damaging	Het
Commd9	G	A	2: 101,901,028	G186D	probably damaging	Het
Cpne9	C	T	6: 113,304,630		probably benign	Het
Crhr2	C	T	6: 55,100,733	V196I	probably damaging	Het
Dctn5	T	A	7: 122,133,329		probably benign	Het
Dhtkd1	C	T	2: 5,924,119	R247Q	probably benign	Het
Dmrta1	G	A	4: 89,691,756	G318R	possibly damaging	Het
Dpp6	T	A	5: 27,663,501	Y487*	probably null	Het
Eef1akmt3	A	T	10: 127,033,247	N119K	probably damaging	Het
Eloa	A	T	4: 136,012,885	L75Q	probably damaging	Het
Fat3	G	A	9: 16,085,308	T1202M	probably damaging	Het
Fcho2	A	G	13: 98,777,474	I205T	possibly damaging	Het
Fkbp10	A	C	11: 100,421,023	D174A	probably damaging	Het
Gcnt2	T	A	13: 40,861,176	F274L	probably damaging	Het
Gtf3c1	A	T	7: 125,667,368	C969S	probably damaging	Het
Hook3	T	C	8: 26,061,422	E130G	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Itsn1	T	A	16: 91,818,591		probably benign	Het
Kif13b	C	T	14: 64,806,114	R1788C	probably damaging	Het
Kif3a	C	T	11: 53,598,726	S135F	probably damaging	Het
Klf5	C	T	14: 99,301,459	R23*	probably null	Het
Lcn5	A	G	2: 25,658,011	I11V	probably benign	Het
Mpp7	A	T	18: 7,458,930		probably null	Het
Mroh5	T	C	15: 73,787,969	I338V	probably benign	Het
Mthfd2l	A	G	5: 90,948,898	N126S	possibly damaging	Het
Myo18b	G	T	5: 112,757,573	A2053E	possibly damaging	Het
Naip6	A	T	13: 100,303,304	C318*	probably null	Het
Ndufs7	C	T	10: 80,254,924	R116C	possibly damaging	Het
Olfr1378	T	C	11: 50,969,108	M30T	probably benign	Het
Pnkd	T	C	1: 74,349,737	V214A	possibly damaging	Het
Popdc2	T	G	16: 38,362,901	V82G	probably benign	Het
Prkdc	A	T	16: 15,769,875	L2541F	possibly damaging	Het
Ptpn9	A	T	9: 57,020,037	H66L	possibly damaging	Het
Pygm	T	A	19: 6,390,382	N397K	probably damaging	Het
Rabgap1l	T	A	1: 160,722,147	E324D	probably damaging	Het
Rnf6	G	A	5: 146,210,280	R643C	probably damaging	Het
Ryr2	C	T	13: 11,655,713	V3466M	probably damaging	Het
Scn7a	A	G	2: 66,676,346	Y1400H	probably damaging	Het
Sept10	T	A	10: 59,176,959	N279I	probably damaging	Het
Sh3rf2	A	T	18: 42,141,014	Y415F	probably benign	Het
Sorcs1	T	C	19: 50,252,602	T449A	probably benign	Het
Tcam1	C	T	11: 106,285,423	T325M	probably damaging	Het
Tctn1	A	G	5: 122,258,879	I147T	probably benign	Het
Tet1	G	T	10: 62,814,451	H30Q	probably benign	Het
Tmem109	A	G	19: 10,872,014	I159T	probably damaging	Het
Tmem40	C	T	6: 115,759,031		probably benign	Het
Uaca	A	G	9: 60,871,451	D1038G	probably benign	Het
Ubr2	C	G	17: 46,963,697	E852D	probably benign	Het
Ubr3	A	T	2: 69,944,390	N518I	probably damaging	Het
Unc80	T	G	1: 66,654,578	L2596R	possibly damaging	Het
Zcchc3	G	A	2: 152,414,732	P16S	probably benign	Het

Other mutations in Tnfrsf21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Tnfrsf21	APN	17	43037946	missense	probably damaging	1.00
IGL01663:Tnfrsf21	APN	17	43087811	missense	probably benign	0.13
IGL01811:Tnfrsf21	APN	17	43037613	missense	probably benign
IGL01916:Tnfrsf21	APN	17	43039803	missense	probably benign	0.00
IGL01934:Tnfrsf21	APN	17	43065187	missense	probably benign	0.15
IGL02184:Tnfrsf21	APN	17	43085463	missense	probably benign	0.37
IGL02292:Tnfrsf21	APN	17	43039911	missense	probably benign
IGL02385:Tnfrsf21	APN	17	43040051	missense	probably damaging	1.00
IGL02710:Tnfrsf21	APN	17	43087929	missense	probably damaging	0.97
IGL03001:Tnfrsf21	APN	17	43087895	missense	probably damaging	0.99
IGL03003:Tnfrsf21	APN	17	43039943	missense	probably damaging	1.00
palmer_park	UTSW	17	43038010	missense	probably damaging	1.00
PIT4480001:Tnfrsf21	UTSW	17	43037911	missense	probably benign	0.00
R0007:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0046:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0088:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0091:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0103:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0206:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0211:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0240:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0243:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0308:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0363:Tnfrsf21	UTSW	17	43037877	missense	probably benign	0.01
R0456:Tnfrsf21	UTSW	17	43038091	missense	probably benign	0.01
R0522:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0523:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0525:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0528:Tnfrsf21	UTSW	17	43037614	missense	probably benign
R0543:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0549:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0550:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0699:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0724:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0734:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0847:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0880:Tnfrsf21	UTSW	17	43037842	nonsense	probably null
R1591:Tnfrsf21	UTSW	17	43085374	missense	probably benign	0.01
R2069:Tnfrsf21	UTSW	17	43037938	missense	possibly damaging	0.67
R2153:Tnfrsf21	UTSW	17	43087872	missense	probably damaging	1.00
R2323:Tnfrsf21	UTSW	17	43085529	nonsense	probably null
R3941:Tnfrsf21	UTSW	17	43038010	missense	probably damaging	1.00
R4438:Tnfrsf21	UTSW	17	43087842	missense	possibly damaging	0.49
R4509:Tnfrsf21	UTSW	17	43085388	missense	probably benign	0.00
R4510:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4511:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4708:Tnfrsf21	UTSW	17	43038232	missense	possibly damaging	0.66
R4721:Tnfrsf21	UTSW	17	43085504	missense	probably damaging	1.00
R4811:Tnfrsf21	UTSW	17	43037730	missense	probably benign	0.00
R5767:Tnfrsf21	UTSW	17	43037659	missense	probably damaging	0.98
R6057:Tnfrsf21	UTSW	17	43039715	missense	possibly damaging	0.86
R6392:Tnfrsf21	UTSW	17	43017088	missense	probably benign	0.00
R6860:Tnfrsf21	UTSW	17	43017066	missense	probably benign
R7253:Tnfrsf21	UTSW	17	43037667	missense	probably benign	0.00
R7288:Tnfrsf21	UTSW	17	43037818	missense	possibly damaging	0.86
R7643:Tnfrsf21	UTSW	17	43037916	missense	probably benign	0.00
R7937:Tnfrsf21	UTSW	17	43037925	missense	probably benign	0.01
R8098:Tnfrsf21	UTSW	17	43039899	missense	probably benign
V3553:Tnfrsf21	UTSW	17	43037931	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGTTGACCGTACCACTGGC -3'
(R):5'- TGAGCTTTACACTTCATCACACTGG -3'

Sequencing Primer
(F):5'- TACCACTGGCCAGGTGCTAAC -3'
(R):5'- TTTACACTTCATCACACTGGAAGGC -3'

Posted On

2016-09-01