Mutagenetix > Incidental Mutation

Incidental Mutation 'R5437:Mpp7'

428452

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

043002-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R5437 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 7458930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000115869

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Meta Mutation Damage Score

0.9481

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Acaca	G	A	11: 84,346,820		probably null	Het
Acsm3	C	A	7: 119,778,497		probably benign	Het
Aoc1	C	A	6: 48,907,750	Q576K	probably benign	Het
Atp6v0a4	T	A	6: 38,076,733	N378I	probably damaging	Het
BC003331	T	G	1: 150,363,518	I385L	probably benign	Het
Cacna1i	A	T	15: 80,371,529	H871L	probably damaging	Het
Clic4	C	G	4: 135,217,246	R206P	probably damaging	Het
Commd9	G	A	2: 101,901,028	G186D	probably damaging	Het
Cpne9	C	T	6: 113,304,630		probably benign	Het
Crhr2	C	T	6: 55,100,733	V196I	probably damaging	Het
Dctn5	T	A	7: 122,133,329		probably benign	Het
Dhtkd1	C	T	2: 5,924,119	R247Q	probably benign	Het
Dmrta1	G	A	4: 89,691,756	G318R	possibly damaging	Het
Dpp6	T	A	5: 27,663,501	Y487*	probably null	Het
Eef1akmt3	A	T	10: 127,033,247	N119K	probably damaging	Het
Eloa	A	T	4: 136,012,885	L75Q	probably damaging	Het
Fat3	G	A	9: 16,085,308	T1202M	probably damaging	Het
Fcho2	A	G	13: 98,777,474	I205T	possibly damaging	Het
Fkbp10	A	C	11: 100,421,023	D174A	probably damaging	Het
Gcnt2	T	A	13: 40,861,176	F274L	probably damaging	Het
Gtf3c1	A	T	7: 125,667,368	C969S	probably damaging	Het
Hook3	T	C	8: 26,061,422	E130G	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Itsn1	T	A	16: 91,818,591		probably benign	Het
Kif13b	C	T	14: 64,806,114	R1788C	probably damaging	Het
Kif3a	C	T	11: 53,598,726	S135F	probably damaging	Het
Klf5	C	T	14: 99,301,459	R23*	probably null	Het
Lcn5	A	G	2: 25,658,011	I11V	probably benign	Het
Mroh5	T	C	15: 73,787,969	I338V	probably benign	Het
Mthfd2l	A	G	5: 90,948,898	N126S	possibly damaging	Het
Myo18b	G	T	5: 112,757,573	A2053E	possibly damaging	Het
Naip6	A	T	13: 100,303,304	C318*	probably null	Het
Ndufs7	C	T	10: 80,254,924	R116C	possibly damaging	Het
Olfr1378	T	C	11: 50,969,108	M30T	probably benign	Het
Pnkd	T	C	1: 74,349,737	V214A	possibly damaging	Het
Popdc2	T	G	16: 38,362,901	V82G	probably benign	Het
Prkdc	A	T	16: 15,769,875	L2541F	possibly damaging	Het
Ptpn9	A	T	9: 57,020,037	H66L	possibly damaging	Het
Pygm	T	A	19: 6,390,382	N397K	probably damaging	Het
Rabgap1l	T	A	1: 160,722,147	E324D	probably damaging	Het
Rnf6	G	A	5: 146,210,280	R643C	probably damaging	Het
Ryr2	C	T	13: 11,655,713	V3466M	probably damaging	Het
Scn7a	A	G	2: 66,676,346	Y1400H	probably damaging	Het
Sept10	T	A	10: 59,176,959	N279I	probably damaging	Het
Sh3rf2	A	T	18: 42,141,014	Y415F	probably benign	Het
Sorcs1	T	C	19: 50,252,602	T449A	probably benign	Het
Tcam1	C	T	11: 106,285,423	T325M	probably damaging	Het
Tctn1	A	G	5: 122,258,879	I147T	probably benign	Het
Tet1	G	T	10: 62,814,451	H30Q	probably benign	Het
Tmem109	A	G	19: 10,872,014	I159T	probably damaging	Het
Tmem40	C	T	6: 115,759,031		probably benign	Het
Tnfrsf21	C	T	17: 43,037,862	P122S	possibly damaging	Het
Uaca	A	G	9: 60,871,451	D1038G	probably benign	Het
Ubr2	C	G	17: 46,963,697	E852D	probably benign	Het
Ubr3	A	T	2: 69,944,390	N518I	probably damaging	Het
Unc80	T	G	1: 66,654,578	L2596R	possibly damaging	Het
Zcchc3	G	A	2: 152,414,732	P16S	probably benign	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCATATACCGAGCCTCTGAAC -3'
(R):5'- ATCCTGTAGCTCTGGAAAGC -3'

Sequencing Primer
(F):5'- ATGAATTCACCACGTCAATGAG -3'
(R):5'- TGTAGCTCTGGAAAGCAAACCTTC -3'

Posted On

2016-09-01