Incidental Mutation 'R5437:Sorcs1'
ID 428456
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 043002-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5437 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50241040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 449 (T449A)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211687] [ENSMUST00000211008]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072685
AA Change: T449A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: T449A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111756
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: T449A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164039
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: T449A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168357
AA Change: T26A
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531
AA Change: T26A

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209413
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000209783
AA Change: T449A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000211687
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000211008
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.3696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,210,622 (GRCm39) Q186* probably null Het
Acaca G A 11: 84,237,646 (GRCm39) probably null Het
Acsm3 C A 7: 119,377,720 (GRCm39) probably benign Het
Aoc1 C A 6: 48,884,684 (GRCm39) Q576K probably benign Het
Atp6v0a4 T A 6: 38,053,668 (GRCm39) N378I probably damaging Het
Cacna1i A T 15: 80,255,730 (GRCm39) H871L probably damaging Het
Clic4 C G 4: 134,944,557 (GRCm39) R206P probably damaging Het
Commd9 G A 2: 101,731,373 (GRCm39) G186D probably damaging Het
Cpne9 C T 6: 113,281,591 (GRCm39) probably benign Het
Crhr2 C T 6: 55,077,718 (GRCm39) V196I probably damaging Het
Dctn5 T A 7: 121,732,552 (GRCm39) probably benign Het
Dhtkd1 C T 2: 5,928,930 (GRCm39) R247Q probably benign Het
Dmrta1 G A 4: 89,579,993 (GRCm39) G318R possibly damaging Het
Dpp6 T A 5: 27,868,499 (GRCm39) Y487* probably null Het
Eef1akmt3 A T 10: 126,869,116 (GRCm39) N119K probably damaging Het
Eloa A T 4: 135,740,196 (GRCm39) L75Q probably damaging Het
Fat3 G A 9: 15,996,604 (GRCm39) T1202M probably damaging Het
Fcho2 A G 13: 98,913,982 (GRCm39) I205T possibly damaging Het
Fkbp10 A C 11: 100,311,849 (GRCm39) D174A probably damaging Het
Gcnt2 T A 13: 41,014,652 (GRCm39) F274L probably damaging Het
Gtf3c1 A T 7: 125,266,540 (GRCm39) C969S probably damaging Het
Hook3 T C 8: 26,551,450 (GRCm39) E130G probably benign Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Itsn1 T A 16: 91,615,479 (GRCm39) probably benign Het
Kif13b C T 14: 65,043,563 (GRCm39) R1788C probably damaging Het
Kif3a C T 11: 53,489,553 (GRCm39) S135F probably damaging Het
Klf5 C T 14: 99,538,895 (GRCm39) R23* probably null Het
Lcn5 A G 2: 25,548,023 (GRCm39) I11V probably benign Het
Mpp7 A T 18: 7,458,930 (GRCm39) probably null Het
Mroh5 T C 15: 73,659,818 (GRCm39) I338V probably benign Het
Mthfd2l A G 5: 91,096,757 (GRCm39) N126S possibly damaging Het
Myo18b G T 5: 112,905,439 (GRCm39) A2053E possibly damaging Het
Naip6 A T 13: 100,439,812 (GRCm39) C318* probably null Het
Ndufs7 C T 10: 80,090,758 (GRCm39) R116C possibly damaging Het
Odr4 T G 1: 150,239,269 (GRCm39) I385L probably benign Het
Or1ad6 T C 11: 50,859,935 (GRCm39) M30T probably benign Het
Pnkd T C 1: 74,388,896 (GRCm39) V214A possibly damaging Het
Popdc2 T G 16: 38,183,263 (GRCm39) V82G probably benign Het
Prkdc A T 16: 15,587,739 (GRCm39) L2541F possibly damaging Het
Ptpn9 A T 9: 56,927,321 (GRCm39) H66L possibly damaging Het
Pygm T A 19: 6,440,412 (GRCm39) N397K probably damaging Het
Rabgap1l T A 1: 160,549,717 (GRCm39) E324D probably damaging Het
Rnf6 G A 5: 146,147,090 (GRCm39) R643C probably damaging Het
Ryr2 C T 13: 11,670,599 (GRCm39) V3466M probably damaging Het
Scn7a A G 2: 66,506,690 (GRCm39) Y1400H probably damaging Het
Septin10 T A 10: 59,012,781 (GRCm39) N279I probably damaging Het
Sh3rf2 A T 18: 42,274,079 (GRCm39) Y415F probably benign Het
Tcam1 C T 11: 106,176,249 (GRCm39) T325M probably damaging Het
Tctn1 A G 5: 122,396,942 (GRCm39) I147T probably benign Het
Tet1 G T 10: 62,650,230 (GRCm39) H30Q probably benign Het
Tmem109 A G 19: 10,849,378 (GRCm39) I159T probably damaging Het
Tmem40 C T 6: 115,735,992 (GRCm39) probably benign Het
Tnfrsf21 C T 17: 43,348,753 (GRCm39) P122S possibly damaging Het
Uaca A G 9: 60,778,733 (GRCm39) D1038G probably benign Het
Ubr2 C G 17: 47,274,623 (GRCm39) E852D probably benign Het
Ubr3 A T 2: 69,774,734 (GRCm39) N518I probably damaging Het
Unc80 T G 1: 66,693,737 (GRCm39) L2596R possibly damaging Het
Zcchc3 G A 2: 152,256,652 (GRCm39) P16S probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTAAAGTGAAGAGAGGCTGTCC -3'
(R):5'- GGAAGCATGCTCTATCTCTCC -3'

Sequencing Primer
(F):5'- GCTGTCCAAGGAACCAGCATTAG -3'
(R):5'- ACACGCTTTGGATGCATGC -3'
Posted On 2016-09-01