Incidental Mutation 'R5438:Olfr1031'
ID 428460
Institutional Source Beutler Lab
Gene Symbol Olfr1031
Ensembl Gene ENSMUSG00000043267
Gene Name olfactory receptor 1031
Synonyms GA_x6K02T2Q125-47470765-47471775, MOR200-1
MMRRC Submission 043003-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R5438 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 85990304-85993704 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85992581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 255 (F255L)
Ref Sequence ENSEMBL: ENSMUSP00000149225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050942] [ENSMUST00000056849] [ENSMUST00000216807]
AlphaFold Q7TR87
Predicted Effect probably damaging
Transcript: ENSMUST00000050942
AA Change: F255L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059256
Gene: ENSMUSG00000043267
AA Change: F255L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-55 PFAM
Pfam:7tm_1 40 289 6.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216807
AA Change: F255L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Olfr1031
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Olfr1031 APN 2 85992386 missense probably damaging 1.00
IGL02475:Olfr1031 APN 2 85992032 missense probably benign 0.19
IGL03230:Olfr1031 APN 2 85992239 missense probably benign 0.00
IGL03405:Olfr1031 APN 2 85991886 missense possibly damaging 0.84
PIT4151001:Olfr1031 UTSW 2 85992194 missense probably damaging 0.96
PIT4366001:Olfr1031 UTSW 2 85992041 missense probably damaging 1.00
R0344:Olfr1031 UTSW 2 85992382 nonsense probably null
R1168:Olfr1031 UTSW 2 85992684 missense probably damaging 1.00
R1170:Olfr1031 UTSW 2 85992696 missense probably damaging 1.00
R2345:Olfr1031 UTSW 2 85991822 missense probably benign 0.01
R2915:Olfr1031 UTSW 2 85992045 missense probably damaging 1.00
R3498:Olfr1031 UTSW 2 85992430 missense probably benign 0.43
R4058:Olfr1031 UTSW 2 85992232 missense possibly damaging 0.87
R4747:Olfr1031 UTSW 2 85991927 missense probably damaging 1.00
R4859:Olfr1031 UTSW 2 85992731 missense probably damaging 0.96
R4991:Olfr1031 UTSW 2 85992287 missense probably damaging 0.99
R6362:Olfr1031 UTSW 2 85991941 missense probably damaging 1.00
R7458:Olfr1031 UTSW 2 85992650 missense probably damaging 1.00
R7535:Olfr1031 UTSW 2 85991901 missense probably benign 0.37
R8807:Olfr1031 UTSW 2 85992828 makesense probably null
R9130:Olfr1031 UTSW 2 85992475 nonsense probably null
R9366:Olfr1031 UTSW 2 85992387 missense possibly damaging 0.88
R9687:Olfr1031 UTSW 2 85991876 missense probably benign
R9746:Olfr1031 UTSW 2 85992747 missense probably benign 0.18
R9794:Olfr1031 UTSW 2 85992120 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGCTGGCTTGTTCTGACAC -3'
(R):5'- GTTCCACGAGTGCAAAAGAAAATTG -3'

Sequencing Primer
(F):5'- AGAAACCTCCATGCTTGTTGTAGC -3'
(R):5'- CGAGTGCAAAAGAAAATTGAATTCC -3'
Posted On 2016-09-01