Incidental Mutation 'R5438:Elp4'
ID428461
Institutional Source Beutler Lab
Gene Symbol Elp4
Ensembl Gene ENSMUSG00000027167
Gene Nameelongator acetyltransferase complex subunit 4
SynonymsA330107A17Rik, Paxneb
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5438 (G1)
Quality Score188
Status Not validated
Chromosome2
Chromosomal Location105701027-105904564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105904403 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 29 (F29S)
Ref Sequence ENSEMBL: ENSMUSP00000116575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037499] [ENSMUST00000122965]
Predicted Effect probably benign
Transcript: ENSMUST00000037499
SMART Domains Protein: ENSMUSP00000049044
Gene: ENSMUSG00000042670

DomainStartEndE-ValueType
Pfam:Peptidase_S24 36 107 1.8e-16 PFAM
Pfam:Peptidase_S26 95 146 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122965
AA Change: F29S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167
AA Change: F29S

DomainStartEndE-ValueType
Pfam:PAXNEB 28 422 4e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148441
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. This gene has also been associated with Rolandic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Elp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Elp4 APN 2 105842366 splice site probably benign
IGL01407:Elp4 APN 2 105792308 missense probably damaging 1.00
IGL02173:Elp4 APN 2 105702743 missense probably damaging 0.96
IGL02370:Elp4 APN 2 105794592 missense probably damaging 1.00
R0125:Elp4 UTSW 2 105792214 critical splice donor site probably null
R0685:Elp4 UTSW 2 105792277 missense possibly damaging 0.94
R0893:Elp4 UTSW 2 105896945 splice site probably benign
R1117:Elp4 UTSW 2 105842311 missense probably benign 0.00
R1496:Elp4 UTSW 2 105832161 missense probably benign 0.31
R1542:Elp4 UTSW 2 105794609 missense probably benign 0.02
R1911:Elp4 UTSW 2 105702743 missense probably damaging 0.96
R2311:Elp4 UTSW 2 105842332 missense probably benign 0.00
R2997:Elp4 UTSW 2 105814316 missense possibly damaging 0.82
R3079:Elp4 UTSW 2 105809445 missense possibly damaging 0.95
R3683:Elp4 UTSW 2 105702761 missense possibly damaging 0.75
R4747:Elp4 UTSW 2 105794607 missense probably damaging 1.00
R4799:Elp4 UTSW 2 105809267 missense probably damaging 0.99
R5635:Elp4 UTSW 2 105814264 critical splice donor site probably null
R6414:Elp4 UTSW 2 105904443 missense possibly damaging 0.94
R7228:Elp4 UTSW 2 105792302 missense probably damaging 1.00
R7381:Elp4 UTSW 2 105792307 missense not run
R7560:Elp4 UTSW 2 105794588 missense probably damaging 1.00
R7671:Elp4 UTSW 2 105904481 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCAAGTTTCTCCTGGAACG -3'
(R):5'- GCGATTGGTTGACCTGCAAG -3'

Sequencing Primer
(F):5'- GGAACGCGCCCACATATTTATTCTG -3'
(R):5'- TGGTTGACCTGCAAGGAAATCTC -3'
Posted On2016-09-01