Incidental Mutation 'R5438:Gdap2'
ID428466
Institutional Source Beutler Lab
Gene Symbol Gdap2
Ensembl Gene ENSMUSG00000027865
Gene Nameganglioside-induced differentiation-associated-protein 2
SynonymsD3Ertd801e
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5438 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100162381-100206981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100178313 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 184 (I184F)
Ref Sequence ENSEMBL: ENSMUSP00000102610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029459] [ENSMUST00000106997]
Predicted Effect probably damaging
Transcript: ENSMUST00000029459
AA Change: I184F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029459
Gene: ENSMUSG00000027865
AA Change: I184F

DomainStartEndE-ValueType
Pfam:Macro 72 185 1.3e-30 PFAM
low complexity region 265 274 N/A INTRINSIC
SEC14 334 482 5.41e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106997
AA Change: I184F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102610
Gene: ENSMUSG00000027865
AA Change: I184F

DomainStartEndE-ValueType
Pfam:Macro 72 185 4.4e-32 PFAM
low complexity region 265 274 N/A INTRINSIC
SEC14 334 482 5.41e-20 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Gdap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Gdap2 APN 3 100170927 missense possibly damaging 0.62
IGL02342:Gdap2 APN 3 100178316 missense probably damaging 1.00
IGL02684:Gdap2 APN 3 100171020 missense probably benign 0.13
R0128:Gdap2 UTSW 3 100201995 missense probably damaging 1.00
R0130:Gdap2 UTSW 3 100201995 missense probably damaging 1.00
R0344:Gdap2 UTSW 3 100178256 missense probably damaging 1.00
R0588:Gdap2 UTSW 3 100170001 start codon destroyed probably null 1.00
R1521:Gdap2 UTSW 3 100194615 missense possibly damaging 0.61
R2168:Gdap2 UTSW 3 100187883 missense probably benign
R3040:Gdap2 UTSW 3 100188035 critical splice donor site probably null
R4793:Gdap2 UTSW 3 100170918 missense probably damaging 1.00
R5406:Gdap2 UTSW 3 100191675 missense probably damaging 1.00
R5987:Gdap2 UTSW 3 100202256 intron probably benign
R6816:Gdap2 UTSW 3 100191705 critical splice donor site probably null
R7307:Gdap2 UTSW 3 100202033 missense unknown
R7424:Gdap2 UTSW 3 100202066 missense unknown
R7673:Gdap2 UTSW 3 100191699 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGGCTTGAAAGGATCTCTC -3'
(R):5'- CCTGTAAGCCGTTATGCATAGG -3'

Sequencing Primer
(F):5'- GCTTGAAAGGATCTCTCAGAGTATG -3'
(R):5'- GGTGCTCTCTGGTTAGAAC -3'
Posted On2016-09-01