Incidental Mutation 'R5438:Smad1'
ID428478
Institutional Source Beutler Lab
Gene Symbol Smad1
Ensembl Gene ENSMUSG00000031681
Gene NameSMAD family member 1
SynonymsMadh1, Smad 1, Madr1
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5438 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location79338395-79399518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79356320 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 184 (F184I)
Ref Sequence ENSEMBL: ENSMUSP00000105511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066091] [ENSMUST00000109885]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066081
SMART Domains Protein: ENSMUSP00000064015
Gene: ENSMUSG00000031681

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066091
AA Change: F184I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071035
Gene: ENSMUSG00000031681
AA Change: F184I

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 441 2.73e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109885
AA Change: F184I

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105511
Gene: ENSMUSG00000031681
AA Change: F184I

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 425 3.92e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215983
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired allantois formation resulting in the lack of a placenta, and die around embryonic day 9-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Smad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Smad1 APN 8 79356469 missense probably damaging 0.97
IGL01792:Smad1 APN 8 79372123 missense probably damaging 1.00
R0395:Smad1 UTSW 8 79349782 missense probably benign 0.01
R0400:Smad1 UTSW 8 79371770 splice site probably benign
R0990:Smad1 UTSW 8 79343788 missense probably damaging 1.00
R1371:Smad1 UTSW 8 79349578 splice site probably benign
R1481:Smad1 UTSW 8 79343730 missense probably benign 0.20
R1661:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1665:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1797:Smad1 UTSW 8 79343844 missense probably damaging 1.00
R2879:Smad1 UTSW 8 79353455 splice site probably null
R3624:Smad1 UTSW 8 79339698 missense probably benign 0.31
R3791:Smad1 UTSW 8 79339770 missense probably damaging 1.00
R3815:Smad1 UTSW 8 79343730 missense probably benign 0.20
R3819:Smad1 UTSW 8 79343730 missense probably benign 0.20
R4887:Smad1 UTSW 8 79349752 missense probably damaging 1.00
X0064:Smad1 UTSW 8 79353404 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTGCTCAGGGATCAGACTG -3'
(R):5'- GGTCGTTAACAGTTTTCACCGTTC -3'

Sequencing Primer
(F):5'- TCAGGGATCAGACTGCCTCC -3'
(R):5'- AACAGTTTTCACCGTTCTTATTTGTC -3'
Posted On2016-09-01