Incidental Mutation 'R5438:Ighv3-1'
ID 428485
Institutional Source Beutler Lab
Gene Symbol Ighv3-1
Ensembl Gene ENSMUSG00000093838
Gene Name immunoglobulin heavy variable 3-1
Synonyms Gm16610
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R5438 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 113964388-113964818 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113964469 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 90 (H90L)
Ref Sequence ENSEMBL: ENSMUSP00000100259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103478]
AlphaFold A0A075B5S6
Predicted Effect probably benign
Transcript: ENSMUST00000103478
AA Change: H90L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100259
Gene: ENSMUSG00000093838
AA Change: H90L

DomainStartEndE-ValueType
IGv 35 116 9.51e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192729
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Ighv3-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4458001:Ighv3-1 UTSW 12 113964604 missense probably benign 0.03
R4077:Ighv3-1 UTSW 12 113964487 missense probably damaging 0.97
R5563:Ighv3-1 UTSW 12 113964586 missense probably benign 0.12
R7748:Ighv3-1 UTSW 12 113964650 missense probably damaging 0.98
R8460:Ighv3-1 UTSW 12 113964436 nonsense probably null
R9117:Ighv3-1 UTSW 12 113964469 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATTGGTGTATGCTCCATGCCC -3'
(R):5'- AAGGTATCCTGTCTGATGTGCAG -3'

Sequencing Primer
(F):5'- ATGCCCCCTGTTGGTGCAG -3'
(R):5'- GGCATGGTGAAACCTTCTCAGTC -3'
Posted On 2016-09-01