Incidental Mutation 'R5438:Sncg'
ID428488
Institutional Source Beutler Lab
Gene Symbol Sncg
Ensembl Gene ENSMUSG00000023064
Gene Namesynuclein, gamma
Synonymspersyn, C79089
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5438 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34370274-34374789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34373680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 52 (V52I)
Ref Sequence ENSEMBL: ENSMUSP00000023826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023826] [ENSMUST00000111908]
Predicted Effect probably benign
Transcript: ENSMUST00000023826
AA Change: V52I

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023826
Gene: ENSMUSG00000023064
AA Change: V52I

DomainStartEndE-ValueType
Pfam:Synuclein 1 123 6.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111908
SMART Domains Protein: ENSMUSP00000107539
Gene: ENSMUSG00000041445

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 55 127 1.1e-15 PFAM
low complexity region 174 186 N/A INTRINSIC
low complexity region 356 362 N/A INTRINSIC
coiled coil region 387 480 N/A INTRINSIC
coiled coil region 533 583 N/A INTRINSIC
coiled coil region 688 715 N/A INTRINSIC
Pfam:C1q 821 940 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227130
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synuclein family of proteins which are believed to be involved in the pathogenesis of neurodegenerative diseases. Mutations in this gene have also been associated with breast tumor development. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no morphological or functional abnormalities of the nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Sncg
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0008:Sncg UTSW 14 34374538 missense probably benign 0.38
R4680:Sncg UTSW 14 34373311 missense probably benign 0.00
R4827:Sncg UTSW 14 34373327 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACTCTAGGGCAGAACAATG -3'
(R):5'- AGTAACAGTACCTCAGGCCTGG -3'

Sequencing Primer
(F):5'- GCAGAACAATGTGATGGTCTATC -3'
(R):5'- AGTACCTCAGGCCTGGTCTATTTTG -3'
Posted On2016-09-01