Incidental Mutation 'R5438:Tex33'
ID428491
Institutional Source Beutler Lab
Gene Symbol Tex33
Ensembl Gene ENSMUSG00000062154
Gene Nametestis expressed 33
Synonyms1700061J05Rik
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5438 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78378400-78395912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78378840 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 180 (T180A)
Ref Sequence ENSEMBL: ENSMUSP00000130849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074380] [ENSMUST00000165170] [ENSMUST00000169575]
Predicted Effect probably benign
Transcript: ENSMUST00000074380
AA Change: T205A

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073984
Gene: ENSMUSG00000062154
AA Change: T205A

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 63 71 N/A INTRINSIC
Pfam:TEX33 128 266 4.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165170
AA Change: T205A

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133264
Gene: ENSMUSG00000062154
AA Change: T205A

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 63 71 N/A INTRINSIC
Pfam:TEX33 128 265 1.7e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169575
AA Change: T180A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130849
Gene: ENSMUSG00000062154
AA Change: T180A

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
Pfam:TEX33 103 241 9.6e-73 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Tex33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Tex33 APN 15 78386238 missense probably damaging 1.00
IGL02554:Tex33 APN 15 78378536 missense possibly damaging 0.92
IGL03153:Tex33 APN 15 78385316 missense probably damaging 0.98
R0201:Tex33 UTSW 15 78378828 missense probably damaging 0.96
R1557:Tex33 UTSW 15 78386274 missense probably damaging 0.99
R1828:Tex33 UTSW 15 78386388 missense possibly damaging 0.62
R1891:Tex33 UTSW 15 78378752 missense probably damaging 1.00
R5121:Tex33 UTSW 15 78386173 missense probably benign 0.40
R6076:Tex33 UTSW 15 78386227 missense possibly damaging 0.66
R6156:Tex33 UTSW 15 78378813 missense probably damaging 1.00
R7105:Tex33 UTSW 15 78386118 missense possibly damaging 0.81
R7530:Tex33 UTSW 15 78386316 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTCTTCAGATCCACCTCAAGG -3'
(R):5'- GTTGAAAGCAGACCTCACCC -3'

Sequencing Primer
(F):5'- AGGAACCCCCTCCTGCTC -3'
(R):5'- CTATGTACAGAATCTGAAGCTCGG -3'
Posted On2016-09-01