Incidental Mutation 'R5438:Capn13'
ID428496
Institutional Source Beutler Lab
Gene Symbol Capn13
Ensembl Gene ENSMUSG00000043705
Gene Namecalpain 13
SynonymsLOC381122
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5438 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location73306464-73399296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73326484 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 525 (F525L)
Ref Sequence ENSEMBL: ENSMUSP00000092832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095208]
Predicted Effect probably benign
Transcript: ENSMUST00000095208
AA Change: F525L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092832
Gene: ENSMUSG00000043705
AA Change: F525L

DomainStartEndE-ValueType
CysPc 12 337 3.23e-113 SMART
Pfam:Calpain_III 341 473 2e-13 PFAM
SCOP:d1k94a_ 512 664 3e-8 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Capn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Capn13 APN 17 73339425 missense possibly damaging 0.82
IGL01099:Capn13 APN 17 73351509 missense probably damaging 0.99
IGL01613:Capn13 APN 17 73331058 missense probably benign 0.07
IGL02215:Capn13 APN 17 73330998 missense probably damaging 1.00
IGL02403:Capn13 APN 17 73351426 missense possibly damaging 0.82
IGL02877:Capn13 APN 17 73322055 missense probably damaging 0.97
IGL03113:Capn13 APN 17 73331113 missense probably benign 0.00
IGL03246:Capn13 APN 17 73382860 missense probably benign
IGL03369:Capn13 APN 17 73341154 splice site probably benign
R0116:Capn13 UTSW 17 73351524 missense probably damaging 1.00
R0729:Capn13 UTSW 17 73322069 missense probably damaging 1.00
R0745:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0746:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0778:Capn13 UTSW 17 73351508 missense probably benign 0.39
R1252:Capn13 UTSW 17 73367227 missense possibly damaging 0.80
R1594:Capn13 UTSW 17 73351479 missense probably benign 0.15
R1641:Capn13 UTSW 17 73382894 missense possibly damaging 0.91
R1895:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R1902:Capn13 UTSW 17 73326361 missense probably damaging 1.00
R1946:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R2184:Capn13 UTSW 17 73365948 missense probably damaging 1.00
R2427:Capn13 UTSW 17 73326317 splice site probably benign
R2963:Capn13 UTSW 17 73315263 critical splice donor site probably null
R3755:Capn13 UTSW 17 73331119 nonsense probably null
R3759:Capn13 UTSW 17 73322077 missense probably benign 0.01
R3795:Capn13 UTSW 17 73337392 missense probably benign 0.14
R3801:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3802:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3803:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3804:Capn13 UTSW 17 73339401 missense probably benign 0.00
R4084:Capn13 UTSW 17 73337449 missense probably benign 0.00
R4194:Capn13 UTSW 17 73339484 missense possibly damaging 0.48
R4326:Capn13 UTSW 17 73331108 missense probably benign
R4788:Capn13 UTSW 17 73337432 nonsense probably null
R4852:Capn13 UTSW 17 73351506 frame shift probably null
R4853:Capn13 UTSW 17 73351506 frame shift probably null
R4855:Capn13 UTSW 17 73351506 frame shift probably null
R5063:Capn13 UTSW 17 73322079 nonsense probably null
R5112:Capn13 UTSW 17 73351506 frame shift probably null
R5955:Capn13 UTSW 17 73331002 missense possibly damaging 0.92
R6408:Capn13 UTSW 17 73365959 nonsense probably null
R6512:Capn13 UTSW 17 73382990 missense probably benign 0.44
R7425:Capn13 UTSW 17 73318058 missense probably benign 0.13
R7605:Capn13 UTSW 17 73345137 critical splice donor site probably null
R7678:Capn13 UTSW 17 73315305 missense probably damaging 1.00
R7776:Capn13 UTSW 17 73322054 missense probably benign 0.07
R7791:Capn13 UTSW 17 73382888 missense possibly damaging 0.88
Z1176:Capn13 UTSW 17 73341110 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGAATCCCAGGCAAGCCC -3'
(R):5'- GGAGGGAGTTATCAACATAGCC -3'

Sequencing Primer
(F):5'- GGGATTGATTGCAAAGGATACATCC -3'
(R):5'- GGGAGTTATCAACATAGCCAGAACC -3'
Posted On2016-09-01