Incidental Mutation 'R5439:Mcf2l'
ID428522
Institutional Source Beutler Lab
Gene Symbol Mcf2l
Ensembl Gene ENSMUSG00000031442
Gene Namemcf.2 transforming sequence-like
SynonymsC130040G20Rik, Dbs
MMRRC Submission 043004-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5439 (G1)
Quality Score165
Status Not validated
Chromosome8
Chromosomal Location12873806-13020905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12926646 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 2 (A2T)
Ref Sequence ENSEMBL: ENSMUSP00000096528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000173099]
Predicted Effect probably benign
Transcript: ENSMUST00000095456
SMART Domains Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 75 221 1.77e-24 SMART
SPEC 354 455 4.41e-15 SMART
coiled coil region 507 529 N/A INTRINSIC
low complexity region 578 594 N/A INTRINSIC
RhoGEF 636 811 2.83e-63 SMART
PH 831 948 8.13e-14 SMART
low complexity region 966 978 N/A INTRINSIC
SH3 1058 1115 3.33e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098927
AA Change: A2T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442
AA Change: A2T

DomainStartEndE-ValueType
SEC14 49 195 1.77e-24 SMART
SPEC 328 429 4.41e-15 SMART
coiled coil region 481 503 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
RhoGEF 610 785 2.83e-63 SMART
PH 805 922 8.13e-14 SMART
low complexity region 940 952 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110876
SMART Domains Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1084 1141 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110879
SMART Domains Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1028 1085 3.33e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156405
Predicted Effect probably benign
Transcript: ENSMUST00000173099
SMART Domains Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 41 187 1.77e-24 SMART
SPEC 320 421 4.41e-15 SMART
coiled coil region 473 495 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
RhoGEF 602 777 2.83e-63 SMART
PH 797 914 8.13e-14 SMART
low complexity region 932 944 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C A 4: 53,042,381 R1897L possibly damaging Het
Ablim2 A G 5: 35,857,826 K461E probably damaging Het
Acss3 A T 10: 106,937,147 Y659* probably null Het
Actr8 T G 14: 29,986,995 L253R probably damaging Het
Arid4b A G 13: 14,187,696 K915R probably damaging Het
C3 T C 17: 57,204,502 E1560G probably benign Het
Cacna1c A T 6: 118,654,372 I1013N probably damaging Het
Cep83 G A 10: 94,789,738 R670H probably benign Het
Col19a1 T A 1: 24,293,112 D870V probably damaging Het
Ddr2 A G 1: 170,004,729 V164A possibly damaging Het
Donson A T 16: 91,679,926 V549E probably damaging Het
Egflam C T 15: 7,224,663 G824R probably damaging Het
Extl3 A G 14: 65,054,626 F916S probably damaging Het
Fam110c A G 12: 31,074,407 M123V unknown Het
G3bp1 A T 11: 55,497,987 I342F probably damaging Het
Gm438 A T 4: 144,778,113 I156N probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hspb1 A T 5: 135,889,332 T178S probably benign Het
Iigp1 A G 18: 60,390,257 Y149C probably damaging Het
Il22 G T 10: 118,209,461 G159* probably null Het
Jcad T C 18: 4,675,790 F1184S probably damaging Het
Kcnj2 G T 11: 111,072,231 V150L probably damaging Het
Kifc1 C T 17: 33,886,665 R56Q probably damaging Het
Lce1h A G 3: 92,763,720 S42P unknown Het
Lrp4 C A 2: 91,497,073 D1471E probably benign Het
Lrrc3 C A 10: 77,901,465 V46L probably benign Het
Med12l G A 3: 59,263,213 C1673Y probably null Het
Nckap1 T C 2: 80,512,690 E955G possibly damaging Het
Ndufs3 T A 2: 90,902,346 probably null Het
Nkx6-1 A G 5: 101,661,832 probably null Het
Obscn C A 11: 59,000,128 E1713* probably null Het
Olfr1335 G A 4: 118,809,363 T167I possibly damaging Het
Olfr134 T A 17: 38,176,026 probably null Het
Olfr148 A G 9: 39,613,620 T18A probably benign Het
Olfr1511 A G 14: 52,390,125 F216S probably damaging Het
Olfr429 A G 1: 174,089,975 R312G probably benign Het
Olfr58 A C 9: 19,783,865 H244P probably damaging Het
Olfr893 A G 9: 38,209,754 T234A probably benign Het
Osbpl5 A G 7: 143,741,696 F10L possibly damaging Het
Plvap A C 8: 71,511,451 I89S probably damaging Het
Ppp2r2a A G 14: 67,022,323 V308A possibly damaging Het
Ppp2r5e T C 12: 75,493,476 S132G probably benign Het
Pum3 G T 19: 27,412,259 Q398K probably benign Het
Ralgapa2 T C 2: 146,342,510 T1526A probably benign Het
Sh3tc2 T A 18: 61,989,633 Y488* probably null Het
Spata48 A T 11: 11,490,244 R8S possibly damaging Het
Sqle A G 15: 59,330,904 Y537C probably benign Het
Sult2a8 T G 7: 14,425,514 K60T probably damaging Het
Tex15 T C 8: 33,574,171 S1210P possibly damaging Het
Thumpd3 A G 6: 113,066,864 silent Het
Timeless A G 10: 128,241,735 D228G probably damaging Het
Trim31 A T 17: 36,905,905 probably null Het
Ttc39c A T 18: 12,695,371 D196V possibly damaging Het
Wbp4 C A 14: 79,472,397 V133L possibly damaging Het
Wdr92 A G 11: 17,212,031 D23G possibly damaging Het
Zfp354c G T 11: 50,815,770 D159E probably benign Het
Zfp940 C A 7: 29,845,433 D350Y probably benign Het
Other mutations in Mcf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Mcf2l APN 8 13000857 missense probably damaging 0.98
IGL00426:Mcf2l APN 8 12984910 missense probably damaging 1.00
IGL01391:Mcf2l APN 8 13014010 splice site probably null
IGL01795:Mcf2l APN 8 13000749 unclassified probably null
IGL02314:Mcf2l APN 8 13001851 missense probably damaging 0.99
IGL02716:Mcf2l APN 8 12997277 missense probably benign 0.19
IGL02985:Mcf2l APN 8 12963239 missense probably damaging 1.00
IGL03073:Mcf2l APN 8 13000004 missense probably damaging 1.00
IGL03308:Mcf2l APN 8 13009512 missense probably damaging 1.00
IGL03371:Mcf2l APN 8 13001298 missense probably damaging 1.00
P0022:Mcf2l UTSW 8 13018897 nonsense probably null
R0062:Mcf2l UTSW 8 13006766 unclassified probably benign
R0067:Mcf2l UTSW 8 13013060 missense probably benign 0.01
R0110:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0450:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0469:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0510:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0543:Mcf2l UTSW 8 12996728 critical splice donor site probably null
R0591:Mcf2l UTSW 8 13018751 missense probably benign 0.11
R0801:Mcf2l UTSW 8 13014020 intron probably benign
R0962:Mcf2l UTSW 8 13001964 missense probably benign 0.14
R1084:Mcf2l UTSW 8 13002645 missense possibly damaging 0.94
R1794:Mcf2l UTSW 8 12915982 missense probably benign 0.33
R2111:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R2112:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R3785:Mcf2l UTSW 8 12880099 missense probably damaging 0.97
R4777:Mcf2l UTSW 8 13018051 splice site probably null
R4858:Mcf2l UTSW 8 13013972 missense probably damaging 1.00
R4980:Mcf2l UTSW 8 12984883 missense probably damaging 1.00
R5021:Mcf2l UTSW 8 13011808 missense probably damaging 1.00
R5067:Mcf2l UTSW 8 12915959 intron probably benign
R5158:Mcf2l UTSW 8 13009715 missense probably damaging 1.00
R5569:Mcf2l UTSW 8 13005481 missense probably damaging 1.00
R5655:Mcf2l UTSW 8 13010444 missense probably damaging 0.98
R5668:Mcf2l UTSW 8 13013812 nonsense probably null
R5753:Mcf2l UTSW 8 12999993 missense probably damaging 1.00
R5808:Mcf2l UTSW 8 12993937 start codon destroyed probably null 0.92
R5946:Mcf2l UTSW 8 13013922 missense probably damaging 1.00
R6168:Mcf2l UTSW 8 13001823 missense probably benign 0.05
R6174:Mcf2l UTSW 8 13013849 nonsense probably null
R6212:Mcf2l UTSW 8 13017431 missense probably damaging 1.00
R6270:Mcf2l UTSW 8 13018701 missense probably damaging 0.99
R6383:Mcf2l UTSW 8 12879912 start gained probably benign
R6850:Mcf2l UTSW 8 13009476 missense possibly damaging 0.82
R6908:Mcf2l UTSW 8 13018919 missense probably benign
R7101:Mcf2l UTSW 8 13013579 missense possibly damaging 0.80
R7163:Mcf2l UTSW 8 12915439 missense probably benign 0.00
R7203:Mcf2l UTSW 8 13010456 missense probably benign 0.09
R7414:Mcf2l UTSW 8 13019022 makesense probably null
R7553:Mcf2l UTSW 8 12997268 missense probably benign
R7556:Mcf2l UTSW 8 12973071 missense probably damaging 0.99
X0052:Mcf2l UTSW 8 13018713 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCACCTGTTTCTCGTGACAG -3'
(R):5'- TTAAGGGTCCTGCAAGTACCAC -3'

Sequencing Primer
(F):5'- GTTTCTCGTGACAGCTCAGGAC -3'
(R):5'- GGTGTCATTTCTCCTGAC -3'
Posted On2016-09-01