Mutagenetix > Incidental Mutation

Incidental Mutation 'R5439:Olfr134'

428557

Institutional Source

Beutler Lab

Gene Symbol

Olfr134

Ensembl Gene

ENSMUSG00000096009

Gene Name

olfactory receptor 134

Synonyms

MOR256-5, GA_x6K02T2PSCP-2623613-2624551

MMRRC Submission

043004-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R5439 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38171388-38176578 bp(+) (GRCm38)

Type of Mutation

splice site (2 bp from exon)

DNA Base Change (assembly)

T to A at 38176026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000074423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074883] [ENSMUST00000215900]

AlphaFold

Q8VG95

Predicted Effect

probably null
Transcript: ENSMUST00000074883

SMART Domains

Protein: ENSMUSP00000074423
Gene: ENSMUSG00000096009

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	3.4e-50	PFAM
Pfam:7tm_1	41	290	2e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215900

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	C	A	4: 53,042,381	R1897L	possibly damaging	Het
Ablim2	A	G	5: 35,857,826	K461E	probably damaging	Het
Acss3	A	T	10: 106,937,147	Y659*	probably null	Het
Actr8	T	G	14: 29,986,995	L253R	probably damaging	Het
Arid4b	A	G	13: 14,187,696	K915R	probably damaging	Het
C3	T	C	17: 57,204,502	E1560G	probably benign	Het
Cacna1c	A	T	6: 118,654,372	I1013N	probably damaging	Het
Cep83	G	A	10: 94,789,738	R670H	probably benign	Het
Col19a1	T	A	1: 24,293,112	D870V	probably damaging	Het
Ddr2	A	G	1: 170,004,729	V164A	possibly damaging	Het
Donson	A	T	16: 91,679,926	V549E	probably damaging	Het
Egflam	C	T	15: 7,224,663	G824R	probably damaging	Het
Extl3	A	G	14: 65,054,626	F916S	probably damaging	Het
Fam110c	A	G	12: 31,074,407	M123V	unknown	Het
G3bp1	A	T	11: 55,497,987	I342F	probably damaging	Het
Gm438	A	T	4: 144,778,113	I156N	probably damaging	Het
Golgb1	A	G	16: 36,900,508	N409D	probably benign	Het
Grin2b	C	T	6: 135,736,306	G859D	probably damaging	Het
Hspb1	A	T	5: 135,889,332	T178S	probably benign	Het
Iigp1	A	G	18: 60,390,257	Y149C	probably damaging	Het
Il22	G	T	10: 118,209,461	G159*	probably null	Het
Jcad	T	C	18: 4,675,790	F1184S	probably damaging	Het
Kcnj2	G	T	11: 111,072,231	V150L	probably damaging	Het
Kifc1	C	T	17: 33,886,665	R56Q	probably damaging	Het
Lce1h	A	G	3: 92,763,720	S42P	unknown	Het
Lrp4	C	A	2: 91,497,073	D1471E	probably benign	Het
Lrrc3	C	A	10: 77,901,465	V46L	probably benign	Het
Mcf2l	G	A	8: 12,926,646	A2T	possibly damaging	Het
Med12l	G	A	3: 59,263,213	C1673Y	probably null	Het
Nckap1	T	C	2: 80,512,690	E955G	possibly damaging	Het
Ndufs3	T	A	2: 90,902,346		probably null	Het
Nkx6-1	A	G	5: 101,661,832		probably null	Het
Obscn	C	A	11: 59,000,128	E1713*	probably null	Het
Olfr1335	G	A	4: 118,809,363	T167I	possibly damaging	Het
Olfr148	A	G	9: 39,613,620	T18A	probably benign	Het
Olfr1511	A	G	14: 52,390,125	F216S	probably damaging	Het
Olfr429	A	G	1: 174,089,975	R312G	probably benign	Het
Olfr58	A	C	9: 19,783,865	H244P	probably damaging	Het
Olfr893	A	G	9: 38,209,754	T234A	probably benign	Het
Osbpl5	A	G	7: 143,741,696	F10L	possibly damaging	Het
Plvap	A	C	8: 71,511,451	I89S	probably damaging	Het
Ppp2r2a	A	G	14: 67,022,323	V308A	possibly damaging	Het
Ppp2r5e	T	C	12: 75,493,476	S132G	probably benign	Het
Pum3	G	T	19: 27,412,259	Q398K	probably benign	Het
Ralgapa2	T	C	2: 146,342,510	T1526A	probably benign	Het
Sh3tc2	T	A	18: 61,989,633	Y488*	probably null	Het
Spata48	A	T	11: 11,490,244	R8S	possibly damaging	Het
Sqle	A	G	15: 59,330,904	Y537C	probably benign	Het
Sult2a8	T	G	7: 14,425,514	K60T	probably damaging	Het
Tex15	T	C	8: 33,574,171	S1210P	possibly damaging	Het
Thumpd3	A	G	6: 113,066,864		silent	Het
Timeless	A	G	10: 128,241,735	D228G	probably damaging	Het
Trim31	A	T	17: 36,905,905		probably null	Het
Ttc39c	A	T	18: 12,695,371	D196V	possibly damaging	Het
Wbp4	C	A	14: 79,472,397	V133L	possibly damaging	Het
Wdr92	A	G	11: 17,212,031	D23G	possibly damaging	Het
Zfp354c	G	T	11: 50,815,770	D159E	probably benign	Het
Zfp940	C	A	7: 29,845,433	D350Y	probably benign	Het

Other mutations in Olfr134

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01677:Olfr134	APN	17	38175875	missense	probably damaging	1.00
IGL01749:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL01750:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL01751:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL01753:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL01757:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL01765:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL01766:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL01767:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL01822:Olfr134	APN	17	38175448	missense	probably damaging	1.00
IGL02256:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL02257:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL02258:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL02259:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL02275:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL02293:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL02295:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL02317:Olfr134	APN	17	38175686	missense	probably benign	0.04
IGL02318:Olfr134	APN	17	38175686	missense	probably benign	0.04
R0230:Olfr134	UTSW	17	38175950	missense	probably damaging	1.00
R0363:Olfr134	UTSW	17	38175447	missense	probably damaging	1.00
R1074:Olfr134	UTSW	17	38175440	missense	probably damaging	1.00
R1506:Olfr134	UTSW	17	38175200	missense	probably benign
R2300:Olfr134	UTSW	17	38175550	nonsense	probably null
R3743:Olfr134	UTSW	17	38175902	missense	probably damaging	1.00
R3975:Olfr134	UTSW	17	38175495	missense	probably benign	0.03
R4230:Olfr134	UTSW	17	38175881	missense	possibly damaging	0.67
R5158:Olfr134	UTSW	17	38175454	nonsense	probably null
R6144:Olfr134	UTSW	17	38175225	missense	probably damaging	1.00
R6309:Olfr134	UTSW	17	38175519	missense	probably benign	0.00
R6675:Olfr134	UTSW	17	38176014	missense	probably benign
R6800:Olfr134	UTSW	17	38175122	missense	probably benign	0.01
R6873:Olfr134	UTSW	17	38175368	missense	probably benign
R7193:Olfr134	UTSW	17	38175096	missense	probably benign	0.44
R7534:Olfr134	UTSW	17	38175297	missense	probably benign	0.22
R7869:Olfr134	UTSW	17	38175939	missense	possibly damaging	0.94
R7912:Olfr134	UTSW	17	38175267	missense	probably damaging	0.99
R8048:Olfr134	UTSW	17	38175528	missense	probably benign	0.11
R8305:Olfr134	UTSW	17	38175573	missense	probably damaging	1.00
R9396:Olfr134	UTSW	17	38175530	missense	probably damaging	1.00
R9445:Olfr134	UTSW	17	38175803	missense	probably damaging	1.00
X0011:Olfr134	UTSW	17	38175851	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTCCAGCCATTAGTATGTATC -3'
(R):5'- TGGCAATTGCTTTGGAACAATG -3'

Sequencing Primer
(F):5'- GTCCAGCCATTAGTATGTATCTTCAG -3'
(R):5'- GTAAGGATTTCTGCATGTACAAGTAC -3'

Posted On

2016-09-01