Incidental Mutation 'R5440:Vmn2r41'
ID428579
Institutional Source Beutler Lab
Gene Symbol Vmn2r41
Ensembl Gene ENSMUSG00000090892
Gene Namevomeronasal 2, receptor 41
Synonyms
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5440 (G1)
Quality Score215
Status Not validated
Chromosome7
Chromosomal Location8136950-8161654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8138363 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 701 (I701F)
Ref Sequence ENSEMBL: ENSMUSP00000128337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168807]
Predicted Effect probably damaging
Transcript: ENSMUST00000168807
AA Change: I701F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128337
Gene: ENSMUSG00000090892
AA Change: I701F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
Pfam:ANF_receptor 73 468 2.6e-32 PFAM
Pfam:NCD3G 512 565 1.5e-19 PFAM
Pfam:7tm_3 595 834 1.5e-78 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Vmn2r41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02345:Vmn2r41 APN 7 8138768 missense probably damaging 0.99
IGL03342:Vmn2r41 APN 7 8138683 missense probably damaging 0.99
R5103:Vmn2r41 UTSW 7 8138342 missense probably benign 0.00
R6232:Vmn2r41 UTSW 7 8150215 critical splice donor site probably null
R6603:Vmn2r41 UTSW 7 8138360 missense probably damaging 1.00
R7847:Vmn2r41 UTSW 7 8161548 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTTCATTGAATGTGTCAGGC -3'
(R):5'- CCTTCCAAACAGAGCCATTTG -3'

Sequencing Primer
(F):5'- TCAGGCAGATTCTTGGCCAAG -3'
(R):5'- CAGAGCCATTTGTGTCTTACAGCAG -3'
Posted On2016-09-01