Incidental Mutation 'R5440:D7Ertd443e'
ID 428584
Institutional Source Beutler Lab
Gene Symbol D7Ertd443e
Ensembl Gene ENSMUSG00000030994
Gene Name DNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5440 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 134265779-134385661 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 134349275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 223 (T223I)
Ref Sequence ENSEMBL: ENSMUSP00000134479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094002] [ENSMUST00000172947] [ENSMUST00000173195] [ENSMUST00000173754] [ENSMUST00000174700]
AlphaFold D2J0Y4
Predicted Effect probably damaging
Transcript: ENSMUST00000094002
AA Change: T176I

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091539
Gene: ENSMUSG00000030994
AA Change: T176I

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Pfam:ALMS_motif 511 644 3.7e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172947
AA Change: T223I

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134479
Gene: ENSMUSG00000030994
AA Change: T223I

DomainStartEndE-ValueType
low complexity region 226 239 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 525 541 N/A INTRINSIC
Pfam:ALMS_motif 559 689 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173195
Predicted Effect probably benign
Transcript: ENSMUST00000173754
Predicted Effect probably benign
Transcript: ENSMUST00000174700
SMART Domains Protein: ENSMUSP00000134411
Gene: ENSMUSG00000030994

DomainStartEndE-ValueType
Pfam:ALMS_motif 25 98 2.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in D7Ertd443e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:D7Ertd443e APN 7 134349400 missense possibly damaging 0.56
R0369:D7Ertd443e UTSW 7 134298137 missense possibly damaging 0.56
R0501:D7Ertd443e UTSW 7 134294972 missense probably damaging 1.00
R1073:D7Ertd443e UTSW 7 134270218 missense probably damaging 1.00
R1083:D7Ertd443e UTSW 7 134348934 nonsense probably null
R1744:D7Ertd443e UTSW 7 134349413 missense probably benign 0.00
R1801:D7Ertd443e UTSW 7 134270212 missense probably damaging 1.00
R1807:D7Ertd443e UTSW 7 134293305 missense probably null 1.00
R2050:D7Ertd443e UTSW 7 134266798 missense probably damaging 1.00
R2273:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2274:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2504:D7Ertd443e UTSW 7 134349479 splice site probably null
R3699:D7Ertd443e UTSW 7 134349068 missense probably damaging 1.00
R4348:D7Ertd443e UTSW 7 134348953 frame shift probably null
R4516:D7Ertd443e UTSW 7 134293328 missense probably damaging 1.00
R5123:D7Ertd443e UTSW 7 134349668 splice site probably null
R5555:D7Ertd443e UTSW 7 134349591 missense probably benign 0.00
R5711:D7Ertd443e UTSW 7 134349381 missense probably benign 0.43
R5848:D7Ertd443e UTSW 7 134349722 missense possibly damaging 0.92
R6049:D7Ertd443e UTSW 7 134298232 missense probably benign 0.01
R6266:D7Ertd443e UTSW 7 134349785 missense probably damaging 1.00
R6408:D7Ertd443e UTSW 7 134349711 missense probably benign 0.27
R6939:D7Ertd443e UTSW 7 134364479 splice site probably null
R7195:D7Ertd443e UTSW 7 134295122 missense probably damaging 1.00
R7352:D7Ertd443e UTSW 7 134349394 missense probably benign 0.03
R7737:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R7843:D7Ertd443e UTSW 7 134349095 missense possibly damaging 0.93
R7845:D7Ertd443e UTSW 7 134270248 missense probably damaging 1.00
R8346:D7Ertd443e UTSW 7 134348756 missense possibly damaging 0.63
R9120:D7Ertd443e UTSW 7 134270257 missense probably damaging 1.00
R9166:D7Ertd443e UTSW 7 134298319 missense probably benign 0.01
R9773:D7Ertd443e UTSW 7 134358074 missense probably benign 0.00
Z1088:D7Ertd443e UTSW 7 134294982 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAACTGGTGGGAACTACAGCGG -3'
(R):5'- AGCCAAGGATGCTCTGTTCC -3'

Sequencing Primer
(F):5'- ACAGACCTGTGCATTTTGGG -3'
(R):5'- CCAAGGATGCTCTGTTCCAAGAG -3'
Posted On 2016-09-01