Incidental Mutation 'R5440:Terb1'
ID428586
Institutional Source Beutler Lab
Gene Symbol Terb1
Ensembl Gene ENSMUSG00000052616
Gene Nametelomere repeat binding bouquet formation protein 1
SynonymsCcdc79, 4930532D21Rik
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5440 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104446719-104509910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104488499 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 282 (I282V)
Ref Sequence ENSEMBL: ENSMUSP00000067324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064576] [ENSMUST00000159713] [ENSMUST00000161520]
PDB Structure
Solution structures of the myb-like DNA binding domain of 4930532D21Rik protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000064576
AA Change: I282V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067324
Gene: ENSMUSG00000052616
AA Change: I282V

DomainStartEndE-ValueType
SCOP:d1ee4a_ 2 368 7e-11 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
SANT 711 762 7.07e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159713
AA Change: I282V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124706
Gene: ENSMUSG00000052616
AA Change: I282V

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 335 6e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161520
AA Change: I282V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125431
Gene: ENSMUSG00000052616
AA Change: I282V

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 336 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162014
SMART Domains Protein: ENSMUSP00000123925
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1jdha_ 21 370 7e-8 SMART
low complexity region 382 394 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
low complexity region 688 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male and female mice homozygous for a null allele are infertile with arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Terb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Terb1 APN 8 104451807 missense probably benign 0.09
IGL01468:Terb1 APN 8 104482167 intron probably benign
IGL01619:Terb1 APN 8 104473014 missense probably benign 0.00
IGL01631:Terb1 APN 8 104472864 missense probably damaging 0.99
IGL02041:Terb1 APN 8 104495114 missense probably damaging 1.00
IGL02413:Terb1 APN 8 104494868 critical splice donor site probably null
IGL02974:Terb1 APN 8 104494968 nonsense probably null
IGL03091:Terb1 APN 8 104469154 missense probably benign 0.03
IGL03410:Terb1 APN 8 104473042 splice site probably benign
R0825:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R0906:Terb1 UTSW 8 104452636 missense probably damaging 1.00
R1175:Terb1 UTSW 8 104484306 missense probably benign 0.07
R1494:Terb1 UTSW 8 104498490 splice site probably benign
R1657:Terb1 UTSW 8 104488491 missense possibly damaging 0.77
R2018:Terb1 UTSW 8 104452699 missense probably benign 0.00
R2029:Terb1 UTSW 8 104498100 splice site probably benign
R2047:Terb1 UTSW 8 104485462 missense probably damaging 1.00
R2062:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R2179:Terb1 UTSW 8 104452715 missense probably damaging 0.99
R2179:Terb1 UTSW 8 104472737 missense probably benign 0.08
R2187:Terb1 UTSW 8 104472884 missense probably benign
R2420:Terb1 UTSW 8 104498595 missense probably damaging 1.00
R2867:Terb1 UTSW 8 104447853 unclassified probably benign
R3749:Terb1 UTSW 8 104496834 missense probably damaging 1.00
R4850:Terb1 UTSW 8 104485425 missense probably benign 0.02
R4930:Terb1 UTSW 8 104447948 missense probably benign 0.00
R4963:Terb1 UTSW 8 104482318 missense probably damaging 1.00
R4969:Terb1 UTSW 8 104495163 missense probably benign 0.00
R5100:Terb1 UTSW 8 104495173 nonsense probably null
R5824:Terb1 UTSW 8 104485447 missense probably benign 0.08
R5950:Terb1 UTSW 8 104488485 critical splice donor site probably null
R5985:Terb1 UTSW 8 104451807 missense probably benign 0.09
R5985:Terb1 UTSW 8 104482316 missense probably damaging 1.00
R6320:Terb1 UTSW 8 104447199 missense probably damaging 1.00
R6432:Terb1 UTSW 8 104485446 missense possibly damaging 0.65
R6473:Terb1 UTSW 8 104473037 missense probably damaging 1.00
R6701:Terb1 UTSW 8 104472756 missense possibly damaging 0.69
R7013:Terb1 UTSW 8 104488590 nonsense probably null
R7064:Terb1 UTSW 8 104488554 missense probably benign 0.00
R7237:Terb1 UTSW 8 104495327 missense possibly damaging 0.85
R7361:Terb1 UTSW 8 104468799 missense probably damaging 1.00
R7549:Terb1 UTSW 8 104498084 missense possibly damaging 0.85
R7915:Terb1 UTSW 8 104447216 missense possibly damaging 0.59
R8112:Terb1 UTSW 8 104468767 missense probably benign 0.32
R8256:Terb1 UTSW 8 104472947 missense possibly damaging 0.92
R8329:Terb1 UTSW 8 104484371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAAGTCAGACTTAGATATGAATCC -3'
(R):5'- ACATTATCATTGTACTGTGTCAGGG -3'

Sequencing Primer
(F):5'- CAGCATTCACTGTGTTCA -3'
(R):5'- TCAGGGGGAATGTTACTATGTTAC -3'
Posted On2016-09-01