Incidental Mutation 'R5440:Cwf19l2'
ID428587
Institutional Source Beutler Lab
Gene Symbol Cwf19l2
Ensembl Gene ENSMUSG00000025898
Gene NameCWF19-like 2, cell cycle control (S. pombe)
Synonyms3230401L03Rik
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R5440 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location3403592-3479236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3475549 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 829 (E829K)
Ref Sequence ENSEMBL: ENSMUSP00000027027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027027]
Predicted Effect probably damaging
Transcript: ENSMUST00000027027
AA Change: E829K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027027
Gene: ENSMUSG00000025898
AA Change: E829K

DomainStartEndE-ValueType
low complexity region 64 114 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
coiled coil region 496 524 N/A INTRINSIC
Pfam:CwfJ_C_1 655 779 1.8e-40 PFAM
Pfam:CwfJ_C_2 788 882 4.6e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Cwf19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Cwf19l2 APN 9 3409990 missense probably benign 0.01
IGL00573:Cwf19l2 APN 9 3450161 splice site probably benign
IGL00757:Cwf19l2 APN 9 3460054 missense probably damaging 1.00
IGL00803:Cwf19l2 APN 9 3430810 missense probably benign 0.41
IGL01916:Cwf19l2 APN 9 3477869 missense possibly damaging 0.82
IGL02315:Cwf19l2 APN 9 3410030 missense probably damaging 1.00
IGL02419:Cwf19l2 APN 9 3418777 critical splice donor site probably null
IGL02427:Cwf19l2 APN 9 3456817 missense probably benign 0.00
IGL03026:Cwf19l2 APN 9 3428777 missense probably benign 0.28
IGL03028:Cwf19l2 APN 9 3430622 missense probably benign 0.26
IGL03199:Cwf19l2 APN 9 3477830 missense probably damaging 1.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0532:Cwf19l2 UTSW 9 3431057 missense probably benign 0.38
R0724:Cwf19l2 UTSW 9 3421377 critical splice donor site probably null
R0924:Cwf19l2 UTSW 9 3441047 splice site probably benign
R0947:Cwf19l2 UTSW 9 3421286 missense probably benign 0.16
R1210:Cwf19l2 UTSW 9 3430810 missense probably benign 0.00
R1393:Cwf19l2 UTSW 9 3456818 missense probably benign 0.01
R1541:Cwf19l2 UTSW 9 3456760 missense probably damaging 1.00
R1594:Cwf19l2 UTSW 9 3430973 missense probably benign
R1870:Cwf19l2 UTSW 9 3458802 missense possibly damaging 0.56
R1950:Cwf19l2 UTSW 9 3418674 missense probably benign
R1996:Cwf19l2 UTSW 9 3417947 missense probably benign 0.01
R2005:Cwf19l2 UTSW 9 3430720 missense possibly damaging 0.92
R2246:Cwf19l2 UTSW 9 3430661 missense probably benign 0.16
R2420:Cwf19l2 UTSW 9 3411341 missense possibly damaging 0.80
R3051:Cwf19l2 UTSW 9 3410006 missense probably benign 0.05
R3738:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R3915:Cwf19l2 UTSW 9 3456776 missense probably damaging 1.00
R4034:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4035:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4323:Cwf19l2 UTSW 9 3430452 missense probably damaging 0.99
R4328:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4329:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4692:Cwf19l2 UTSW 9 3428709 missense probably damaging 1.00
R4775:Cwf19l2 UTSW 9 3430973 missense probably benign
R4779:Cwf19l2 UTSW 9 3410035 missense possibly damaging 0.95
R4822:Cwf19l2 UTSW 9 3458839 missense probably damaging 1.00
R4833:Cwf19l2 UTSW 9 3430783 missense probably benign 0.28
R5110:Cwf19l2 UTSW 9 3450012 critical splice acceptor site probably null
R5120:Cwf19l2 UTSW 9 3418761 nonsense probably null
R5164:Cwf19l2 UTSW 9 3475511 missense probably damaging 1.00
R5567:Cwf19l2 UTSW 9 3456831 missense probably damaging 1.00
R5594:Cwf19l2 UTSW 9 3418773 missense probably benign 0.42
R5960:Cwf19l2 UTSW 9 3411404 missense probably benign 0.43
R6222:Cwf19l2 UTSW 9 3454569 nonsense probably null
R6259:Cwf19l2 UTSW 9 3458879 missense probably damaging 1.00
R6688:Cwf19l2 UTSW 9 3450015 missense probably benign 0.00
R6983:Cwf19l2 UTSW 9 3477817 missense probably damaging 1.00
R7063:Cwf19l2 UTSW 9 3430532 missense probably benign 0.03
R7506:Cwf19l2 UTSW 9 3456775 missense probably damaging 1.00
R7733:Cwf19l2 UTSW 9 3450066 missense probably benign 0.19
R7846:Cwf19l2 UTSW 9 3477889 missense probably damaging 1.00
R7900:Cwf19l2 UTSW 9 3460107 missense probably damaging 1.00
R7929:Cwf19l2 UTSW 9 3477889 missense probably damaging 1.00
R7983:Cwf19l2 UTSW 9 3460107 missense probably damaging 1.00
T0722:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0003:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0020:Cwf19l2 UTSW 9 3418662 missense probably damaging 1.00
Z1177:Cwf19l2 UTSW 9 3428782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGATGAAGGTCTGGCTG -3'
(R):5'- CAGTTACTGAGCACACTGCC -3'

Sequencing Primer
(F):5'- GGCTGTCAGAATGAATTATGTTCC -3'
(R):5'- CTGAGCACACTGCCAAAAATGTTTG -3'
Posted On2016-09-01