Incidental Mutation 'R5440:Hint3'
ID428592
Institutional Source Beutler Lab
Gene Symbol Hint3
Ensembl Gene ENSMUSG00000019791
Gene Namehistidine triad nucleotide binding protein 3
Synonyms0610010I17Rik, HINT4
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5440 (G1)
Quality Score145
Status Not validated
Chromosome10
Chromosomal Location30608141-30629632 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 30618351 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000125552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019925] [ENSMUST00000161074]
Predicted Effect probably null
Transcript: ENSMUST00000019925
SMART Domains Protein: ENSMUSP00000019925
Gene: ENSMUSG00000019791

DomainStartEndE-ValueType
Pfam:DcpS_C 25 146 3.7e-33 PFAM
Pfam:HIT 35 138 4.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160646
SMART Domains Protein: ENSMUSP00000125125
Gene: ENSMUSG00000019791

DomainStartEndE-ValueType
Pfam:DcpS_C 1 54 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161074
AA Change: M1K

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125552
Gene: ENSMUSG00000019791
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DcpS_C 30 145 6.6e-36 PFAM
Pfam:HIT 40 137 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217266
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histidine triad proteins, such as HINT3, are nucleotide hydrolases and transferases that act on the alpha-phosphate of ribonucleotides (Brenner, 2002 [PubMed 12119013]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Hint3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2107:Hint3 UTSW 10 30618256 missense probably damaging 1.00
R4579:Hint3 UTSW 10 30610432 missense probably damaging 1.00
R5492:Hint3 UTSW 10 30618249 missense probably benign 0.13
R7041:Hint3 UTSW 10 30610384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTTAGTTCGTCTGCAGAGAC -3'
(R):5'- TTTAGAGGCCGAGCTATCTGG -3'

Sequencing Primer
(F):5'- TCTGCAGAGACAGAAGCCTGC -3'
(R):5'- GAGCTATCTGGTGTGTCCCATAC -3'
Posted On2016-09-01