Incidental Mutation 'R5440:Gucy2e'
ID428596
Institutional Source Beutler Lab
Gene Symbol Gucy2e
Ensembl Gene ENSMUSG00000020890
Gene Nameguanylate cyclase 2e
SynonymsGC1, GC-E, ROS-GC1
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R5440 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69218117-69237036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69223646 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1019 (Y1019C)
Ref Sequence ENSEMBL: ENSMUSP00000104305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]
Predicted Effect probably damaging
Transcript: ENSMUST00000021259
AA Change: Y1019C

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: Y1019C

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108664
AA Change: Y1019C

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: Y1019C

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 2.4e-40 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 560 807 9.5e-23 PFAM
Pfam:Pkinase_Tyr 560 807 7.7e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108665
AA Change: Y1019C

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: Y1019C

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155457
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Gucy2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Gucy2e APN 11 69223097 missense possibly damaging 0.88
IGL01626:Gucy2e APN 11 69232855 missense possibly damaging 0.80
IGL01756:Gucy2e APN 11 69232852 missense probably damaging 0.98
IGL02030:Gucy2e APN 11 69223816 missense probably damaging 1.00
IGL02095:Gucy2e APN 11 69232787 missense possibly damaging 0.48
IGL02387:Gucy2e APN 11 69236116 missense probably benign
IGL02622:Gucy2e APN 11 69225031 missense probably damaging 1.00
IGL02660:Gucy2e APN 11 69232007 missense probably benign 0.18
IGL03181:Gucy2e APN 11 69230182 splice site probably benign
R0110:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0115:Gucy2e UTSW 11 69236632 missense unknown
R0450:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0469:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0497:Gucy2e UTSW 11 69224159 missense probably damaging 1.00
R0510:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R1252:Gucy2e UTSW 11 69235659 missense probably benign
R1535:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
R1700:Gucy2e UTSW 11 69232058 missense probably benign
R2035:Gucy2e UTSW 11 69227532 missense probably benign 0.12
R2179:Gucy2e UTSW 11 69228578 splice site probably null
R3622:Gucy2e UTSW 11 69225051 missense probably damaging 1.00
R4212:Gucy2e UTSW 11 69228123 missense probably damaging 0.99
R4600:Gucy2e UTSW 11 69236168 missense possibly damaging 0.71
R4790:Gucy2e UTSW 11 69228448 missense probably damaging 1.00
R5170:Gucy2e UTSW 11 69235570 missense probably damaging 0.97
R5174:Gucy2e UTSW 11 69236566 missense probably benign
R5586:Gucy2e UTSW 11 69226256 missense probably damaging 1.00
R5668:Gucy2e UTSW 11 69228381 missense probably damaging 1.00
R5820:Gucy2e UTSW 11 69232696 missense probably benign 0.36
R5826:Gucy2e UTSW 11 69236033 missense possibly damaging 0.53
R6169:Gucy2e UTSW 11 69236104 missense probably benign 0.19
R6544:Gucy2e UTSW 11 69235657 missense probably benign
R6815:Gucy2e UTSW 11 69232001 missense possibly damaging 0.86
R7020:Gucy2e UTSW 11 69232793 missense probably benign 0.00
R7592:Gucy2e UTSW 11 69223324 critical splice donor site probably null
R7658:Gucy2e UTSW 11 69226229 nonsense probably null
R7812:Gucy2e UTSW 11 69226243 missense probably damaging 1.00
X0025:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAAACTGGGAGACTCTAC -3'
(R):5'- GCCTTCTGACCCAGCATATC -3'

Sequencing Primer
(F):5'- CTGGGAGACTCTACATCTGCATAG -3'
(R):5'- ACCATGCCTCGGTACTGC -3'
Posted On2016-09-01