Incidental Mutation 'R5440:Apol11b'
ID428604
Institutional Source Beutler Lab
Gene Symbol Apol11b
Ensembl Gene ENSMUSG00000091694
Gene Nameapolipoprotein L 11b
SynonymsA330102K04Rik
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5440 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77633946-77643286 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 77635593 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 96 (K96*)
Ref Sequence ENSEMBL: ENSMUSP00000137890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166623] [ENSMUST00000180949] [ENSMUST00000181154] [ENSMUST00000181467]
Predicted Effect probably null
Transcript: ENSMUST00000166623
AA Change: K96*
SMART Domains Protein: ENSMUSP00000129476
Gene: ENSMUSG00000091694
AA Change: K96*

DomainStartEndE-ValueType
Pfam:ApoL 30 311 8.6e-78 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180949
AA Change: K96*
SMART Domains Protein: ENSMUSP00000137890
Gene: ENSMUSG00000091694
AA Change: K96*

DomainStartEndE-ValueType
Pfam:ApoL 29 323 5.1e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181154
SMART Domains Protein: ENSMUSP00000137798
Gene: ENSMUSG00000091694

DomainStartEndE-ValueType
Pfam:ApoL 29 76 5.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181467
SMART Domains Protein: ENSMUSP00000138009
Gene: ENSMUSG00000091694

DomainStartEndE-ValueType
Pfam:ApoL 1 144 2.3e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Apol11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01295:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01398:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01399:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01400:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01402:Apol11b APN 15 77638019 missense probably damaging 0.99
R1815:Apol11b UTSW 15 77635572 missense probably damaging 1.00
R2327:Apol11b UTSW 15 77637953 missense probably damaging 0.97
R3917:Apol11b UTSW 15 77635304 missense probably benign 0.03
R4424:Apol11b UTSW 15 77637933 critical splice donor site probably null
R4766:Apol11b UTSW 15 77634933 missense probably benign 0.00
R4804:Apol11b UTSW 15 77635266 missense probably damaging 1.00
R5600:Apol11b UTSW 15 77635088 missense probably damaging 0.97
R5866:Apol11b UTSW 15 77640547 missense probably null 0.97
R5997:Apol11b UTSW 15 77635497 missense probably benign 0.01
R6213:Apol11b UTSW 15 77638000 missense possibly damaging 0.82
R6249:Apol11b UTSW 15 77635337 missense probably benign 0.00
R6364:Apol11b UTSW 15 77638058 missense possibly damaging 0.46
R6984:Apol11b UTSW 15 77635346 missense probably benign 0.01
Z1088:Apol11b UTSW 15 77638007 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATGCTGAGAGTGCCAGACTG -3'
(R):5'- GGATCGTGGACATCTAGGATG -3'

Sequencing Primer
(F):5'- AGACTGGCCCCTGCTGTAAC -3'
(R):5'- GTAGAATGGAAAACTTTGGATCTCTG -3'
Posted On2016-09-01