Incidental Mutation 'R5440:Fam186b'
ID428606
Institutional Source Beutler Lab
Gene Symbol Fam186b
Ensembl Gene ENSMUSG00000078907
Gene Namefamily with sequence similarity 186, member B
SynonymsEG545136
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5440 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99271018-99295888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99273853 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 838 (A838T)
Ref Sequence ENSEMBL: ENSMUSP00000104728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109100]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109100
AA Change: A838T

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104728
Gene: ENSMUSG00000078907
AA Change: A838T

DomainStartEndE-ValueType
Blast:FBG 12 193 1e-19 BLAST
low complexity region 354 363 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 789 810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of the FAM186 family, however, its exact function is not known. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Fam186b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Fam186b APN 15 99280318 missense probably benign 0.00
IGL01729:Fam186b APN 15 99280251 missense probably benign 0.02
IGL01948:Fam186b APN 15 99280446 missense probably benign 0.00
IGL02133:Fam186b APN 15 99273703 missense probably damaging 0.96
IGL03010:Fam186b APN 15 99280627 missense possibly damaging 0.80
IGL03371:Fam186b APN 15 99280377 missense probably benign 0.00
R0457:Fam186b UTSW 15 99271285 missense probably benign 0.02
R0522:Fam186b UTSW 15 99280519 missense probably benign 0.00
R0571:Fam186b UTSW 15 99286953 missense probably benign 0.02
R0620:Fam186b UTSW 15 99280128 missense probably benign 0.34
R1575:Fam186b UTSW 15 99286971 missense probably benign 0.00
R1883:Fam186b UTSW 15 99278798 missense probably damaging 0.96
R2144:Fam186b UTSW 15 99280657 missense probably benign 0.00
R2267:Fam186b UTSW 15 99285643 missense probably damaging 0.99
R2332:Fam186b UTSW 15 99280428 missense probably benign 0.42
R2394:Fam186b UTSW 15 99280177 missense probably benign 0.01
R3624:Fam186b UTSW 15 99280515 missense probably benign 0.01
R4681:Fam186b UTSW 15 99280890 missense probably benign 0.00
R4811:Fam186b UTSW 15 99280237 missense probably benign 0.01
R4906:Fam186b UTSW 15 99271321 missense probably damaging 0.99
R5028:Fam186b UTSW 15 99280801 missense probably damaging 0.99
R5047:Fam186b UTSW 15 99280686 missense probably damaging 1.00
R5295:Fam186b UTSW 15 99283874 missense probably damaging 1.00
R5468:Fam186b UTSW 15 99278870 missense possibly damaging 0.93
R5596:Fam186b UTSW 15 99271289 missense possibly damaging 0.90
R5759:Fam186b UTSW 15 99279717 missense probably benign 0.09
R6239:Fam186b UTSW 15 99280434 missense probably benign
R7117:Fam186b UTSW 15 99285590 missense probably damaging 0.98
R7141:Fam186b UTSW 15 99283892 missense probably benign 0.03
R7223:Fam186b UTSW 15 99279837 missense possibly damaging 0.77
R7301:Fam186b UTSW 15 99278748 missense probably benign 0.00
R7441:Fam186b UTSW 15 99280089 missense probably benign 0.00
R7614:Fam186b UTSW 15 99286986 missense probably damaging 1.00
R7825:Fam186b UTSW 15 99283847 missense not run
R7853:Fam186b UTSW 15 99280747 missense probably damaging 1.00
R7936:Fam186b UTSW 15 99280747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCCCAAATCCAGGCTAAG -3'
(R):5'- CACATGAGCCTAGAAGTGGAAC -3'

Sequencing Primer
(F):5'- GGCTAAGCACCCACCCTTG -3'
(R):5'- TGGAACTAGGACACAGAGCCTC -3'
Posted On2016-09-01