Incidental Mutation 'R5440:Apc'
ID 428608
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Name APC, WNT signaling pathway regulator
Synonyms Min, adenomatosis polyposis coli, CC1
MMRRC Submission 043005-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R5440 (G1)
Quality Score 104
Status Not validated
Chromosome 18
Chromosomal Location 34353977-34455605 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 34354213 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000079362
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097631
Predicted Effect probably benign
Transcript: ENSMUST00000115781
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170023
Predicted Effect unknown
Transcript: ENSMUST00000171187
AA Change: V17L
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871
AA Change: V17L

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b T A 15: 77,519,793 (GRCm39) K96* probably null Het
Arhgap35 C T 7: 16,296,849 (GRCm39) G739S probably damaging Het
Atp6v0a4 A C 6: 38,069,752 (GRCm39) F47V probably damaging Het
Bcl9 G A 3: 97,117,881 (GRCm39) P271L probably benign Het
Cd109 T C 9: 78,587,446 (GRCm39) probably null Het
Col12a1 T A 9: 79,521,645 (GRCm39) I2771F probably benign Het
Col6a1 A G 10: 76,559,288 (GRCm39) V116A probably damaging Het
Cpsf2 C G 12: 101,963,138 (GRCm39) L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 (GRCm39) E829K probably damaging Het
D7Ertd443e G A 7: 133,951,004 (GRCm39) T223I probably damaging Het
Dtx4 G A 19: 12,469,681 (GRCm39) R149C probably damaging Het
Fam186b C T 15: 99,171,734 (GRCm39) A838T possibly damaging Het
Fzd4 G T 7: 89,057,326 (GRCm39) E458* probably null Het
Gm17669 C T 18: 67,695,526 (GRCm39) P24S possibly damaging Het
Grin2b C T 6: 135,713,304 (GRCm39) G859D probably damaging Het
Gucy2e T C 11: 69,114,472 (GRCm39) Y1019C probably damaging Het
Gzme T A 14: 56,355,910 (GRCm39) N134I possibly damaging Het
Havcr1 A T 11: 46,643,197 (GRCm39) Y39F probably damaging Het
Hint3 A T 10: 30,494,347 (GRCm39) M1K probably null Het
Hspa4l A G 3: 40,736,008 (GRCm39) K543R probably damaging Het
Ifna9 A G 4: 88,510,048 (GRCm39) probably null Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Lipo2 A G 19: 33,698,258 (GRCm39) I373T probably benign Het
Myo5c T A 9: 75,165,407 (GRCm39) I405N possibly damaging Het
Or10a49 T C 7: 108,467,833 (GRCm39) H176R probably damaging Het
P2rx1 A G 11: 72,899,329 (GRCm39) M108V probably benign Het
Pcsk2 T A 2: 143,388,463 (GRCm39) V18E probably benign Het
Pigr A T 1: 130,777,359 (GRCm39) probably null Het
Pkp1 A T 1: 135,810,230 (GRCm39) C447S probably benign Het
Prom1 T A 5: 44,215,988 (GRCm39) I96F probably benign Het
Prpf4b T C 13: 35,068,076 (GRCm39) probably benign Het
Ropn1 C A 16: 34,491,542 (GRCm39) D102E probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Sphk1 T G 11: 116,425,714 (GRCm39) V17G possibly damaging Het
Syngr1 A G 15: 79,982,219 (GRCm39) N2S probably benign Het
Syt9 T G 7: 107,101,330 (GRCm39) S359A possibly damaging Het
Terb1 T C 8: 105,215,131 (GRCm39) I282V probably damaging Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Ttn A T 2: 76,739,600 (GRCm39) D3646E probably benign Het
Ube2d1 A G 10: 71,091,682 (GRCm39) W141R probably damaging Het
Vmn2r41 T A 7: 8,141,362 (GRCm39) I701F probably damaging Het
Zfp770 T C 2: 114,026,596 (GRCm39) D491G probably benign Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34,449,979 (GRCm39) missense probably benign 0.01
IGL00898:Apc APN 18 34,450,147 (GRCm39) missense probably damaging 1.00
IGL01111:Apc APN 18 34,448,189 (GRCm39) missense possibly damaging 0.95
IGL01347:Apc APN 18 34,450,723 (GRCm39) missense probably damaging 1.00
IGL01375:Apc APN 18 34,446,707 (GRCm39) missense probably damaging 1.00
IGL01805:Apc APN 18 34,451,271 (GRCm39) missense probably benign 0.02
IGL01997:Apc APN 18 34,448,476 (GRCm39) missense probably benign 0.00
IGL02033:Apc APN 18 34,443,772 (GRCm39) missense probably damaging 1.00
IGL02323:Apc APN 18 34,448,863 (GRCm39) nonsense probably null
IGL02373:Apc APN 18 34,449,212 (GRCm39) missense probably damaging 1.00
IGL02379:Apc APN 18 34,431,798 (GRCm39) missense probably benign 0.45
IGL02456:Apc APN 18 34,446,935 (GRCm39) nonsense probably null
IGL02552:Apc APN 18 34,446,035 (GRCm39) missense possibly damaging 0.90
IGL02676:Apc APN 18 34,448,687 (GRCm39) missense probably damaging 1.00
IGL02756:Apc APN 18 34,447,588 (GRCm39) missense probably damaging 1.00
IGL02938:Apc APN 18 34,448,281 (GRCm39) missense probably damaging 0.98
IGL02974:Apc APN 18 34,401,436 (GRCm39) splice site probably benign
IGL03124:Apc APN 18 34,433,038 (GRCm39) missense probably damaging 0.98
IGL03201:Apc APN 18 34,445,429 (GRCm39) missense probably damaging 1.00
IGL03339:Apc APN 18 34,431,527 (GRCm39) missense probably damaging 1.00
FR4304:Apc UTSW 18 34,415,050 (GRCm39) intron probably benign
FR4342:Apc UTSW 18 34,415,052 (GRCm39) intron probably benign
FR4449:Apc UTSW 18 34,415,058 (GRCm39) intron probably benign
FR4449:Apc UTSW 18 34,415,053 (GRCm39) intron probably benign
FR4548:Apc UTSW 18 34,415,051 (GRCm39) intron probably benign
FR4737:Apc UTSW 18 34,415,052 (GRCm39) intron probably benign
FR4976:Apc UTSW 18 34,415,057 (GRCm39) nonsense probably null
FR4976:Apc UTSW 18 34,415,053 (GRCm39) intron probably benign
FR4976:Apc UTSW 18 34,415,051 (GRCm39) intron probably benign
R0385:Apc UTSW 18 34,448,997 (GRCm39) missense probably damaging 1.00
R0535:Apc UTSW 18 34,394,125 (GRCm39) missense probably damaging 1.00
R0561:Apc UTSW 18 34,446,356 (GRCm39) missense possibly damaging 0.94
R0590:Apc UTSW 18 34,449,283 (GRCm39) nonsense probably null
R0626:Apc UTSW 18 34,451,507 (GRCm39) missense probably damaging 1.00
R0991:Apc UTSW 18 34,449,160 (GRCm39) missense probably damaging 1.00
R1564:Apc UTSW 18 34,448,202 (GRCm39) missense probably benign 0.00
R1663:Apc UTSW 18 34,401,378 (GRCm39) missense probably damaging 0.98
R1737:Apc UTSW 18 34,450,075 (GRCm39) missense probably damaging 1.00
R1739:Apc UTSW 18 34,445,371 (GRCm39) missense probably damaging 1.00
R1835:Apc UTSW 18 34,450,130 (GRCm39) missense probably damaging 1.00
R1887:Apc UTSW 18 34,405,521 (GRCm39) missense probably damaging 1.00
R1957:Apc UTSW 18 34,450,388 (GRCm39) missense probably damaging 1.00
R1974:Apc UTSW 18 34,433,057 (GRCm39) missense possibly damaging 0.62
R2005:Apc UTSW 18 34,443,962 (GRCm39) critical splice donor site probably null
R2013:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2014:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2015:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2017:Apc UTSW 18 34,446,655 (GRCm39) missense probably benign 0.00
R2056:Apc UTSW 18 34,449,481 (GRCm39) missense probably damaging 1.00
R2108:Apc UTSW 18 34,402,282 (GRCm39) missense probably damaging 1.00
R2120:Apc UTSW 18 34,409,654 (GRCm39) missense probably damaging 1.00
R2131:Apc UTSW 18 34,445,098 (GRCm39) missense possibly damaging 0.51
R2133:Apc UTSW 18 34,445,098 (GRCm39) missense possibly damaging 0.51
R2291:Apc UTSW 18 34,445,544 (GRCm39) missense probably benign 0.45
R2332:Apc UTSW 18 34,450,112 (GRCm39) missense possibly damaging 0.50
R2360:Apc UTSW 18 34,394,179 (GRCm39) missense probably damaging 1.00
R2407:Apc UTSW 18 34,447,315 (GRCm39) missense possibly damaging 0.77
R2507:Apc UTSW 18 34,449,590 (GRCm39) missense possibly damaging 0.77
R2940:Apc UTSW 18 34,409,723 (GRCm39) missense probably damaging 1.00
R3404:Apc UTSW 18 34,446,655 (GRCm39) missense probably benign 0.00
R3411:Apc UTSW 18 34,402,312 (GRCm39) splice site probably benign
R3778:Apc UTSW 18 34,446,134 (GRCm39) missense probably damaging 1.00
R3826:Apc UTSW 18 34,412,388 (GRCm39) missense possibly damaging 0.93
R4599:Apc UTSW 18 34,451,040 (GRCm39) nonsense probably null
R4611:Apc UTSW 18 34,451,618 (GRCm39) missense probably damaging 1.00
R4664:Apc UTSW 18 34,431,647 (GRCm39) missense probably damaging 0.98
R4969:Apc UTSW 18 34,445,971 (GRCm39) nonsense probably null
R5007:Apc UTSW 18 34,446,016 (GRCm39) missense probably damaging 1.00
R5066:Apc UTSW 18 34,449,158 (GRCm39) missense probably damaging 1.00
R5112:Apc UTSW 18 34,449,162 (GRCm39) nonsense probably null
R5259:Apc UTSW 18 34,447,343 (GRCm39) missense probably benign 0.29
R5508:Apc UTSW 18 34,431,633 (GRCm39) missense probably damaging 0.97
R5512:Apc UTSW 18 34,443,962 (GRCm39) critical splice donor site probably benign
R5850:Apc UTSW 18 34,451,116 (GRCm39) missense possibly damaging 0.94
R5951:Apc UTSW 18 34,450,199 (GRCm39) missense possibly damaging 0.89
R5966:Apc UTSW 18 34,354,140 (GRCm39) utr 5 prime probably benign
R6081:Apc UTSW 18 34,423,164 (GRCm39) missense possibly damaging 0.93
R6116:Apc UTSW 18 34,449,508 (GRCm39) missense probably damaging 1.00
R6351:Apc UTSW 18 34,445,265 (GRCm39) missense probably damaging 1.00
R6354:Apc UTSW 18 34,445,581 (GRCm39) missense probably benign 0.02
R6467:Apc UTSW 18 34,402,252 (GRCm39) missense probably benign 0.22
R6974:Apc UTSW 18 34,431,480 (GRCm39) missense possibly damaging 0.65
R7027:Apc UTSW 18 34,445,129 (GRCm39) missense probably damaging 1.00
R7096:Apc UTSW 18 34,449,010 (GRCm39) missense probably damaging 1.00
R7289:Apc UTSW 18 34,448,324 (GRCm39) missense probably damaging 1.00
R7439:Apc UTSW 18 34,445,126 (GRCm39) missense probably damaging 1.00
R7441:Apc UTSW 18 34,445,126 (GRCm39) missense probably damaging 1.00
R7534:Apc UTSW 18 34,450,015 (GRCm39) missense probably damaging 1.00
R7685:Apc UTSW 18 34,447,261 (GRCm39) missense probably damaging 1.00
R7814:Apc UTSW 18 34,405,592 (GRCm39) missense probably damaging 0.98
R7954:Apc UTSW 18 34,447,321 (GRCm39) missense probably damaging 0.99
R8352:Apc UTSW 18 34,445,804 (GRCm39) missense possibly damaging 0.54
R8452:Apc UTSW 18 34,445,804 (GRCm39) missense possibly damaging 0.54
R8497:Apc UTSW 18 34,446,083 (GRCm39) missense possibly damaging 0.81
R8545:Apc UTSW 18 34,450,084 (GRCm39) missense possibly damaging 0.94
R8554:Apc UTSW 18 34,445,999 (GRCm39) missense probably damaging 1.00
R8955:Apc UTSW 18 34,401,370 (GRCm39) missense probably damaging 1.00
R9014:Apc UTSW 18 34,354,074 (GRCm39) start gained probably benign
R9061:Apc UTSW 18 34,446,251 (GRCm39) missense probably damaging 1.00
R9147:Apc UTSW 18 34,450,710 (GRCm39) missense probably damaging 1.00
R9318:Apc UTSW 18 34,447,040 (GRCm39) missense possibly damaging 0.69
R9521:Apc UTSW 18 34,445,738 (GRCm39) missense probably benign 0.24
R9546:Apc UTSW 18 34,445,311 (GRCm39) missense possibly damaging 0.86
R9547:Apc UTSW 18 34,445,311 (GRCm39) missense possibly damaging 0.86
R9557:Apc UTSW 18 34,451,412 (GRCm39) missense probably damaging 1.00
R9592:Apc UTSW 18 34,443,823 (GRCm39) nonsense probably null
R9675:Apc UTSW 18 34,449,247 (GRCm39) missense probably damaging 1.00
R9736:Apc UTSW 18 34,450,823 (GRCm39) missense probably damaging 1.00
R9792:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
R9793:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
R9795:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
RF046:Apc UTSW 18 34,415,062 (GRCm39) critical splice donor site probably benign
RF063:Apc UTSW 18 34,415,062 (GRCm39) critical splice donor site probably benign
X0021:Apc UTSW 18 34,445,161 (GRCm39) missense probably damaging 1.00
X0025:Apc UTSW 18 34,445,429 (GRCm39) missense probably damaging 1.00
Z1088:Apc UTSW 18 34,446,220 (GRCm39) nonsense probably null
Z1177:Apc UTSW 18 34,447,516 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTCCAACAAGATGGCGAAGG -3'
(R):5'- CCTCCCAGAACTCAGGTTTTG -3'

Sequencing Primer
(F):5'- AGTGTGGCTGCCGGAAAC -3'
(R):5'- AAATGGGCTGGACGACCCAC -3'
Posted On 2016-09-01