Mutagenetix > Incidental Mutations

Incidental Mutation 'R5440:Lipo2'

428611

Institutional Source

Beutler Lab

Gene Symbol

Lipo2

Ensembl Gene

ENSMUSG00000087303

Gene Name

lipase, member O2

Synonyms

Gm8981

MMRRC Submission

043005-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R5440 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33719670-33769142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33720858 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 373 (I373T)

Ref Sequence

ENSEMBL: ENSMUSP00000118907 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025694] [ENSMUST00000147153]

Predicted Effect

probably benign
Transcript: ENSMUST00000025694

SMART Domains

Protein: ENSMUSP00000025694
Gene: ENSMUSG00000024766

Domain	Start	End	E-Value	Type
Pfam:Abhydro_lipase	33	95	4.2e-24	PFAM
Pfam:Abhydrolase_1	76	213	7.3e-16	PFAM
Pfam:Abhydrolase_5	76	370	4.8e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147153
AA Change: I373T

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000118907
Gene: ENSMUSG00000087303
AA Change: I373T

Domain	Start	End	E-Value	Type
Pfam:Abhydro_lipase	33	95	4.4e-24	PFAM
Pfam:Abhydrolase_1	76	213	1.7e-15	PFAM
Pfam:Abhydrolase_5	76	370	1.5e-11	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	G	T	18: 34,221,160		probably benign	Het
Apol11b	T	A	15: 77,635,593	K96*	probably null	Het
Arhgap35	C	T	7: 16,562,924	G739S	probably damaging	Het
Atp6v0a4	A	C	6: 38,092,817	F47V	probably damaging	Het
Bcl9	G	A	3: 97,210,565	P271L	probably benign	Het
Cd109	T	C	9: 78,680,164		probably null	Het
Col12a1	T	A	9: 79,614,363	I2771F	probably benign	Het
Col6a1	A	G	10: 76,723,454	V116A	probably damaging	Het
Cpsf2	C	G	12: 101,996,879	L401V	probably benign	Het
Cwf19l2	G	A	9: 3,475,549	E829K	probably damaging	Het
D7Ertd443e	G	A	7: 134,349,275	T223I	probably damaging	Het
Dtx4	G	A	19: 12,492,317	R149C	probably damaging	Het
Fam186b	C	T	15: 99,273,853	A838T	possibly damaging	Het
Fzd4	G	T	7: 89,408,118	E458*	probably null	Het
Gm17669	C	T	18: 67,562,456	P24S	possibly damaging	Het
Grin2b	C	T	6: 135,736,306	G859D	probably damaging	Het
Gucy2e	T	C	11: 69,223,646	Y1019C	probably damaging	Het
Gzme	T	A	14: 56,118,453	N134I	possibly damaging	Het
Havcr1	A	T	11: 46,752,370	Y39F	probably damaging	Het
Hint3	A	T	10: 30,618,351	M1K	probably null	Het
Hspa4l	A	G	3: 40,781,576	K543R	probably damaging	Het
Ifna9	A	G	4: 88,591,811		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Myo5c	T	A	9: 75,258,125	I405N	possibly damaging	Het
Olfr517	T	C	7: 108,868,626	H176R	probably damaging	Het
P2rx1	A	G	11: 73,008,503	M108V	probably benign	Het
Pcsk2	T	A	2: 143,546,543	V18E	probably benign	Het
Pigr	A	T	1: 130,849,622		probably null	Het
Pkp1	A	T	1: 135,882,492	C447S	probably benign	Het
Prom1	T	A	5: 44,058,646	I96F	probably benign	Het
Prpf4b	T	C	13: 34,884,093		probably benign	Het
Ropn1	C	A	16: 34,671,172	D102E	probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Sphk1	T	G	11: 116,534,888	V17G	possibly damaging	Het
Syngr1	A	G	15: 80,098,018	N2S	probably benign	Het
Syt9	T	G	7: 107,502,123	S359A	possibly damaging	Het
Terb1	T	C	8: 104,488,499	I282V	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Ttn	A	T	2: 76,909,256	D3646E	probably benign	Het
Ube2d1	A	G	10: 71,255,852	W141R	probably damaging	Het
Vmn2r41	T	A	7: 8,138,363	I701F	probably damaging	Het
Zfp770	T	C	2: 114,196,115	D491G	probably benign	Het

Other mutations in Lipo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01564:Lipo2	APN	19	33721024	missense	probably benign	0.03
IGL01780:Lipo2	APN	19	33730948	missense	possibly damaging	0.82
IGL01868:Lipo2	APN	19	33730838	missense	probably benign	0.00
IGL02291:Lipo2	APN	19	33745792	missense	possibly damaging	0.80
IGL02350:Lipo2	APN	19	33730948	missense	possibly damaging	0.82
IGL02357:Lipo2	APN	19	33730948	missense	possibly damaging	0.82
IGL02560:Lipo2	APN	19	33730948	missense	possibly damaging	0.82
IGL03354:Lipo2	APN	19	33730870	missense	probably benign	0.09
R0183:Lipo2	UTSW	19	33749551	splice site	probably null
R0529:Lipo2	UTSW	19	33746935	missense	probably benign	0.05
R0576:Lipo2	UTSW	19	33749424	missense	probably benign	0.02
R0579:Lipo2	UTSW	19	33746898	missense	probably damaging	0.99
R0594:Lipo2	UTSW	19	33746902	missense	possibly damaging	0.95
R0621:Lipo2	UTSW	19	33730939	missense	probably damaging	1.00
R1019:Lipo2	UTSW	19	33730857	nonsense	probably null
R2190:Lipo2	UTSW	19	33748569	missense	probably damaging	1.00
R2413:Lipo2	UTSW	19	33751257	missense	probably damaging	0.98
R4066:Lipo2	UTSW	19	33720859	missense	probably benign	0.01
R4258:Lipo2	UTSW	19	33730928	missense	possibly damaging	0.88
R4365:Lipo2	UTSW	19	33721708	missense	probably damaging	1.00
R4491:Lipo2	UTSW	19	33721700	missense	probably damaging	0.99
R4640:Lipo2	UTSW	19	33720837	missense	probably benign	0.04
R4822:Lipo2	UTSW	19	33745751	missense	probably benign	0.01
R4872:Lipo2	UTSW	19	33749514	missense	probably benign	0.00
R5004:Lipo2	UTSW	19	33721676	critical splice donor site	probably null
R5112:Lipo2	UTSW	19	33748465	missense	probably benign	0.00
R5737:Lipo2	UTSW	19	33721696	missense	probably damaging	1.00
R6209:Lipo2	UTSW	19	33749452	missense	probably damaging	1.00
R6868:Lipo2	UTSW	19	33748462	missense	possibly damaging	0.86
R6893:Lipo2	UTSW	19	33721007	nonsense	probably null
R7176:Lipo2	UTSW	19	33745807	missense	possibly damaging	0.71
R7853:Lipo2	UTSW	19	33759944	start gained	probably benign
R7936:Lipo2	UTSW	19	33759944	start gained	probably benign
X0052:Lipo2	UTSW	19	33720945	missense	probably damaging	1.00
Z1088:Lipo2	UTSW	19	33721685	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACATTCCCTTGATGGTCATAG -3'
(R):5'- GACAAGGGCCAAGCTCAATG -3'

Sequencing Primer
(F):5'- CCCTTGATGGTCATAGTTTTCAC -3'
(R):5'- GGGCCAAGCTCAATGATTTC -3'

Posted On

2016-09-01