Incidental Mutation 'R5440:Lipo2'
ID428611
Institutional Source Beutler Lab
Gene Symbol Lipo2
Ensembl Gene ENSMUSG00000087303
Gene Namelipase, member O2
SynonymsGm8981
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5440 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location33719670-33769142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33720858 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 373 (I373T)
Ref Sequence ENSEMBL: ENSMUSP00000118907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025694] [ENSMUST00000147153]
Predicted Effect probably benign
Transcript: ENSMUST00000025694
SMART Domains Protein: ENSMUSP00000025694
Gene: ENSMUSG00000024766

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.2e-24 PFAM
Pfam:Abhydrolase_1 76 213 7.3e-16 PFAM
Pfam:Abhydrolase_5 76 370 4.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147153
AA Change: I373T

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118907
Gene: ENSMUSG00000087303
AA Change: I373T

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.4e-24 PFAM
Pfam:Abhydrolase_1 76 213 1.7e-15 PFAM
Pfam:Abhydrolase_5 76 370 1.5e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Myo5c T A 9: 75,258,125 I405N possibly damaging Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Lipo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Lipo2 APN 19 33721024 missense probably benign 0.03
IGL01780:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL01868:Lipo2 APN 19 33730838 missense probably benign 0.00
IGL02291:Lipo2 APN 19 33745792 missense possibly damaging 0.80
IGL02350:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL02357:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL02560:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL03354:Lipo2 APN 19 33730870 missense probably benign 0.09
R0183:Lipo2 UTSW 19 33749551 splice site probably null
R0529:Lipo2 UTSW 19 33746935 missense probably benign 0.05
R0576:Lipo2 UTSW 19 33749424 missense probably benign 0.02
R0579:Lipo2 UTSW 19 33746898 missense probably damaging 0.99
R0594:Lipo2 UTSW 19 33746902 missense possibly damaging 0.95
R0621:Lipo2 UTSW 19 33730939 missense probably damaging 1.00
R1019:Lipo2 UTSW 19 33730857 nonsense probably null
R2190:Lipo2 UTSW 19 33748569 missense probably damaging 1.00
R2413:Lipo2 UTSW 19 33751257 missense probably damaging 0.98
R4066:Lipo2 UTSW 19 33720859 missense probably benign 0.01
R4258:Lipo2 UTSW 19 33730928 missense possibly damaging 0.88
R4365:Lipo2 UTSW 19 33721708 missense probably damaging 1.00
R4491:Lipo2 UTSW 19 33721700 missense probably damaging 0.99
R4640:Lipo2 UTSW 19 33720837 missense probably benign 0.04
R4822:Lipo2 UTSW 19 33745751 missense probably benign 0.01
R4872:Lipo2 UTSW 19 33749514 missense probably benign 0.00
R5004:Lipo2 UTSW 19 33721676 critical splice donor site probably null
R5112:Lipo2 UTSW 19 33748465 missense probably benign 0.00
R5737:Lipo2 UTSW 19 33721696 missense probably damaging 1.00
R6209:Lipo2 UTSW 19 33749452 missense probably damaging 1.00
R6868:Lipo2 UTSW 19 33748462 missense possibly damaging 0.86
R6893:Lipo2 UTSW 19 33721007 nonsense probably null
R7176:Lipo2 UTSW 19 33745807 missense possibly damaging 0.71
R7853:Lipo2 UTSW 19 33759944 start gained probably benign
R7936:Lipo2 UTSW 19 33759944 start gained probably benign
X0052:Lipo2 UTSW 19 33720945 missense probably damaging 1.00
Z1088:Lipo2 UTSW 19 33721685 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATTCCCTTGATGGTCATAG -3'
(R):5'- GACAAGGGCCAAGCTCAATG -3'

Sequencing Primer
(F):5'- CCCTTGATGGTCATAGTTTTCAC -3'
(R):5'- GGGCCAAGCTCAATGATTTC -3'
Posted On2016-09-01