Incidental Mutation 'R5404:Cp'
ID428617
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Nameceruloplasmin
SynonymsD3Ertd555e
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19957054-20009145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 19989128 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 1027 (T1027P)
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329] [ENSMUST00000173779] [ENSMUST00000173848]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003714
AA Change: T1026P

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617
AA Change: T1026P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091309
AA Change: T1027P

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617
AA Change: T1027P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108325
AA Change: T1026P

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617
AA Change: T1026P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108328
AA Change: T1026P

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617
AA Change: T1026P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108329
AA Change: T1027P

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617
AA Change: T1027P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect probably benign
Transcript: ENSMUST00000172605
SMART Domains Protein: ENSMUSP00000134347
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
PDB:1KCW|A 2 58 2e-28 PDB
SCOP:d1kcw_5 22 58 4e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172860
AA Change: T163P
SMART Domains Protein: ENSMUSP00000133374
Gene: ENSMUSG00000003617
AA Change: T163P

DomainStartEndE-ValueType
Pfam:Cu-oxidase 53 192 1.4e-6 PFAM
Pfam:Cu-oxidase_2 66 192 4.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173779
SMART Domains Protein: ENSMUSP00000133643
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
SCOP:d1gw0a3 1 37 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173848
SMART Domains Protein: ENSMUSP00000133676
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 16 93 1e-10 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 19985662 missense possibly damaging 0.95
IGL00923:Cp APN 3 19970001 missense probably damaging 1.00
IGL01302:Cp APN 3 19966367 missense probably damaging 0.99
IGL01407:Cp APN 3 19977205 missense possibly damaging 0.79
IGL01505:Cp APN 3 19977192 missense possibly damaging 0.83
IGL01677:Cp APN 3 19966434 missense probably damaging 1.00
IGL02013:Cp APN 3 19988049 missense probably damaging 1.00
IGL02114:Cp APN 3 19966347 missense probably benign 0.16
IGL02950:Cp APN 3 19988001 missense probably damaging 0.99
IGL03330:Cp APN 3 19966435 missense probably damaging 1.00
iron10 UTSW 3 19989148 unclassified probably benign
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0320:Cp UTSW 3 19974848 splice site probably benign
R0632:Cp UTSW 3 19971082 missense probably null 0.98
R1103:Cp UTSW 3 19981985 missense possibly damaging 0.82
R1137:Cp UTSW 3 19978952 missense probably benign 0.04
R1199:Cp UTSW 3 19977152 missense probably damaging 1.00
R1523:Cp UTSW 3 19989065 missense probably benign 0.00
R1629:Cp UTSW 3 19966450 critical splice donor site probably null
R1678:Cp UTSW 3 19972717 missense probably damaging 0.99
R1733:Cp UTSW 3 19968219 splice site probably benign
R1779:Cp UTSW 3 19957385 missense possibly damaging 0.91
R1816:Cp UTSW 3 19968220 splice site probably benign
R1990:Cp UTSW 3 19979013 missense probably damaging 1.00
R2014:Cp UTSW 3 19987434 missense probably benign 0.00
R2179:Cp UTSW 3 19987987 missense probably damaging 1.00
R2249:Cp UTSW 3 19987570 missense probably damaging 1.00
R3440:Cp UTSW 3 19974957 missense probably benign 0.02
R3441:Cp UTSW 3 19974957 missense probably benign 0.02
R3886:Cp UTSW 3 19989111 missense probably damaging 1.00
R3937:Cp UTSW 3 19971034 missense probably damaging 1.00
R4387:Cp UTSW 3 19977202 missense probably damaging 1.00
R4412:Cp UTSW 3 19966353 missense probably damaging 1.00
R4413:Cp UTSW 3 19966353 missense probably damaging 1.00
R4514:Cp UTSW 3 19988013 missense probably damaging 0.99
R4578:Cp UTSW 3 19973888 missense probably damaging 1.00
R4579:Cp UTSW 3 19957435 splice site probably null
R4694:Cp UTSW 3 19974885 missense probably benign 0.07
R4724:Cp UTSW 3 19972647 missense probably benign 0.02
R4910:Cp UTSW 3 19989224 unclassified probably benign
R4960:Cp UTSW 3 19973797 missense probably damaging 0.96
R5043:Cp UTSW 3 19973917 missense probably benign 0.00
R5063:Cp UTSW 3 19989215 missense probably benign 0.27
R5294:Cp UTSW 3 19966316 missense probably benign 0.00
R5382:Cp UTSW 3 19978925 missense probably damaging 1.00
R5569:Cp UTSW 3 19978877 missense probably damaging 1.00
R5789:Cp UTSW 3 19957290 missense probably benign
R5943:Cp UTSW 3 19964306 missense probably benign 0.11
R6492:Cp UTSW 3 19982022 missense probably benign 0.20
R6540:Cp UTSW 3 19964529 critical splice donor site probably null
R7007:Cp UTSW 3 19969973 missense probably damaging 0.97
R7126:Cp UTSW 3 19980624 missense probably damaging 1.00
R7136:Cp UTSW 3 19985658 nonsense probably null
R7212:Cp UTSW 3 19974966 missense probably damaging 1.00
R7269:Cp UTSW 3 19983477 missense probably damaging 1.00
R7316:Cp UTSW 3 19972752 missense probably damaging 1.00
R7336:Cp UTSW 3 19964532 splice site probably null
R7361:Cp UTSW 3 19964306 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTCCGAGGCTTTAGGTAAGAAC -3'
(R):5'- TCACAAGTGCCCTTATACTGG -3'

Sequencing Primer
(F):5'- GGTAAGAACCACAAATTTCAG -3'
(R):5'- GGAGATGTATTTAGGCAAAGCATTC -3'
Posted On2016-09-06