Mutagenetix > Incidental Mutation

Incidental Mutation 'R5404:Grid2'

428620

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

tpr, B230104L07Rik, GluRdelta2

MMRRC Submission

042975-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5404 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63232860-64681307 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63907894 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 178 (I178N)

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852]

AlphaFold

Q61625

Predicted Effect

probably damaging
Transcript: ENSMUST00000095852
AA Change: I178N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: I178N

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159561

SMART Domains

Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	2.7e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161105

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,791,545 (GRCm39)	H297R	probably benign	Het
Ccnk	A	T	12: 108,161,882 (GRCm39)	K262N	possibly damaging	Het
Clec4b2	A	T	6: 123,158,308 (GRCm39)	Y58F	probably benign	Het
Cp	A	C	3: 20,043,292 (GRCm39)	T1027P	possibly damaging	Het
Cpox	G	A	16: 58,495,649 (GRCm39)	G322D	probably damaging	Het
Cry1	T	C	10: 85,020,283 (GRCm39)	N18S	probably damaging	Het
Dnah8	G	A	17: 30,967,542 (GRCm39)	D2585N	probably benign	Het
Dock10	A	G	1: 80,481,630 (GRCm39)		probably benign	Het
Fance	A	T	17: 28,537,034 (GRCm39)	R58W	probably null	Het
Fermt1	T	C	2: 132,776,789 (GRCm39)	D233G	possibly damaging	Het
Gabpa	T	A	16: 84,657,351 (GRCm39)	Y409N	probably damaging	Het
Gpr162	A	G	6: 124,838,606 (GRCm39)	S15P	possibly damaging	Het
Il17re	T	C	6: 113,446,063 (GRCm39)	V233A	probably benign	Het
Lemd3	G	A	10: 120,767,863 (GRCm39)	Q672*	probably null	Het
Myh15	A	G	16: 48,980,341 (GRCm39)	T1488A	probably benign	Het
Narf	T	A	11: 121,133,452 (GRCm39)	H84Q	probably benign	Het
Nedd1	C	T	10: 92,552,054 (GRCm39)	V69I	probably benign	Het
Nfil3	G	A	13: 53,122,091 (GRCm39)	S271F	probably damaging	Het
Npc1	A	G	18: 12,346,356 (GRCm39)	L280P	possibly damaging	Het
Or2n1e	T	A	17: 38,586,517 (GRCm39)	L285*	probably null	Het
Or4p20	C	T	2: 88,254,145 (GRCm39)	V75M	probably damaging	Het
Or51a25	T	A	7: 102,372,807 (GRCm39)	I297F	possibly damaging	Het
Poli	A	G	18: 70,642,503 (GRCm39)	S503P	probably benign	Het
Rbm5	T	C	9: 107,642,752 (GRCm39)	E94G	probably damaging	Het
Robo4	CGG	CG	9: 37,322,786 (GRCm39)		probably null	Het
Rps6ka5	T	C	12: 100,582,352 (GRCm39)	I173M	probably damaging	Het
Slc40a1	A	G	1: 45,951,488 (GRCm39)	L223P	probably damaging	Het
Smg1	T	C	7: 117,806,131 (GRCm39)	K213E	probably damaging	Het
Spem1	T	A	11: 69,711,763 (GRCm39)	K300N	probably damaging	Het
Tchh	A	G	3: 93,354,982 (GRCm39)	E1474G	unknown	Het
Tenm4	A	T	7: 96,543,887 (GRCm39)	R1968W	probably damaging	Het
Tshz2	A	T	2: 169,726,240 (GRCm39)	M279L	probably benign	Het
Tuba3a	G	T	6: 125,258,555 (GRCm39)	T145K	possibly damaging	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64,322,573 (GRCm39)	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64,510,688 (GRCm39)	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64,297,180 (GRCm39)	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64,642,899 (GRCm39)	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64,040,919 (GRCm39)	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64,322,650 (GRCm39)	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64,322,857 (GRCm39)	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64,322,800 (GRCm39)	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64,040,888 (GRCm39)	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64,406,806 (GRCm39)	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63,886,053 (GRCm39)	missense	possibly damaging	0.94
crawler	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
swagger	UTSW	6	64,372,263 (GRCm39)	synonymous	probably benign
R0133:Grid2	UTSW	6	64,297,116 (GRCm39)	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64,510,571 (GRCm39)	missense	probably benign
R0193:Grid2	UTSW	6	64,040,937 (GRCm39)	missense	possibly damaging	0.64
R0370:Grid2	UTSW	6	64,322,718 (GRCm39)	missense	possibly damaging	0.75
R0399:Grid2	UTSW	6	64,643,036 (GRCm39)	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63,480,419 (GRCm39)	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64,643,259 (GRCm39)	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64,406,738 (GRCm39)	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64,406,668 (GRCm39)	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
R1762:Grid2	UTSW	6	64,510,638 (GRCm39)	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63,886,045 (GRCm39)	missense	probably damaging	1.00
R1961:Grid2	UTSW	6	63,885,877 (GRCm39)	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63,885,902 (GRCm39)	nonsense	probably null
R2138:Grid2	UTSW	6	64,322,782 (GRCm39)	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63,480,383 (GRCm39)	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64,297,005 (GRCm39)	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64,322,826 (GRCm39)	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63,480,417 (GRCm39)	missense	probably benign	0.41
R4273:Grid2	UTSW	6	63,886,029 (GRCm39)	missense	probably damaging	1.00
R4591:Grid2	UTSW	6	64,297,086 (GRCm39)	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64,642,899 (GRCm39)	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64,643,185 (GRCm39)	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63,885,972 (GRCm39)	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64,406,724 (GRCm39)	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64,297,136 (GRCm39)	nonsense	probably null
R5091:Grid2	UTSW	6	64,053,862 (GRCm39)	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R5128:Grid2	UTSW	6	64,642,982 (GRCm39)	missense	probably benign	0.01
R5386:Grid2	UTSW	6	63,908,089 (GRCm39)	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63,480,345 (GRCm39)	missense	probably benign
R5626:Grid2	UTSW	6	64,053,929 (GRCm39)	critical splice donor site	probably null
R5699:Grid2	UTSW	6	63,885,975 (GRCm39)	missense	probably damaging	0.99
R5700:Grid2	UTSW	6	64,071,416 (GRCm39)	missense	possibly damaging	0.95
R5876:Grid2	UTSW	6	64,640,146 (GRCm39)	missense	probably damaging	1.00
R6446:Grid2	UTSW	6	64,322,577 (GRCm39)	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63,907,999 (GRCm39)	missense	probably benign	0.01
R6895:Grid2	UTSW	6	64,372,283 (GRCm39)	missense	probably damaging	0.99
R6999:Grid2	UTSW	6	64,053,893 (GRCm39)	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64,677,402 (GRCm39)	missense	unknown
R7126:Grid2	UTSW	6	64,053,794 (GRCm39)	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64,252,854 (GRCm39)	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64,053,925 (GRCm39)	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63,908,085 (GRCm39)	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64,297,120 (GRCm39)	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63,885,891 (GRCm39)	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63,233,929 (GRCm39)	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64,510,635 (GRCm39)	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63,480,321 (GRCm39)	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63,233,923 (GRCm39)	missense	probably benign
R8965:Grid2	UTSW	6	64,296,990 (GRCm39)	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64,643,139 (GRCm39)	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63,885,888 (GRCm39)	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64,677,506 (GRCm39)	missense	unknown
R9653:Grid2	UTSW	6	63,907,968 (GRCm39)	missense	possibly damaging	0.75
Z1176:Grid2	UTSW	6	64,640,212 (GRCm39)	missense	probably benign	0.03
Z1176:Grid2	UTSW	6	63,885,863 (GRCm39)	missense	possibly damaging	0.76
Z1177:Grid2	UTSW	6	64,322,841 (GRCm39)	missense	probably damaging	1.00
Z1177:Grid2	UTSW	6	64,322,840 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAAATGAACCTGCTTTTCCATCC -3'
(R):5'- GGATTCATGACAAGGATGGCTC -3'

Sequencing Primer
(F):5'- ATCATGTGTACCAACTTTTCCCAC -3'
(R):5'- CATGACAAGGATGGCTCTTCTAAG -3'

Posted On

2016-09-06