Incidental Mutation 'R5404:Gpr162'
ID428624
Institutional Source Beutler Lab
Gene Symbol Gpr162
Ensembl Gene ENSMUSG00000038390
Gene NameG protein-coupled receptor 162
SynonymsA-2, Grca
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124858444-124863983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124861643 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 15 (S15P)
Ref Sequence ENSEMBL: ENSMUSP00000145267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024044] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024044
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000046893
AA Change: S15P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390
AA Change: S15P

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204253
Predicted Effect possibly damaging
Transcript: ENSMUST00000204667
AA Change: S15P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390
AA Change: S15P

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified upon genomic analysis of a gene-dense region at human chromosome 12p13. It appears to be mainly expressed in the brain; however, its function is not known. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Gpr162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Gpr162 APN 6 124858857 unclassified probably null
IGL01879:Gpr162 APN 6 124861241 missense probably damaging 1.00
IGL01901:Gpr162 APN 6 124861407 missense possibly damaging 0.95
IGL01930:Gpr162 APN 6 124861612 missense possibly damaging 0.82
IGL02334:Gpr162 APN 6 124861160 missense probably damaging 1.00
R1036:Gpr162 UTSW 6 124860860 missense probably damaging 0.99
R1322:Gpr162 UTSW 6 124858901 missense probably damaging 0.96
R1351:Gpr162 UTSW 6 124861198 missense probably damaging 1.00
R1549:Gpr162 UTSW 6 124860088 missense probably damaging 1.00
R1933:Gpr162 UTSW 6 124861447 missense probably damaging 0.98
R4214:Gpr162 UTSW 6 124860068 missense probably damaging 1.00
R4367:Gpr162 UTSW 6 124861695 start gained probably benign
R4628:Gpr162 UTSW 6 124861442 missense probably benign 0.03
R5290:Gpr162 UTSW 6 124861269 missense probably benign 0.17
R5354:Gpr162 UTSW 6 124859637 missense probably benign 0.06
R5465:Gpr162 UTSW 6 124861171 missense probably damaging 1.00
R5520:Gpr162 UTSW 6 124860913 missense probably damaging 1.00
R5566:Gpr162 UTSW 6 124860938 nonsense probably null
R6184:Gpr162 UTSW 6 124861241 missense probably damaging 1.00
R6450:Gpr162 UTSW 6 124861189 missense possibly damaging 0.84
R6685:Gpr162 UTSW 6 124861531 missense probably damaging 1.00
R6807:Gpr162 UTSW 6 124861201 missense probably damaging 0.97
R6972:Gpr162 UTSW 6 124861309 missense probably damaging 0.99
R6982:Gpr162 UTSW 6 124860956 missense probably damaging 1.00
R7543:Gpr162 UTSW 6 124861392 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGTCAGAGGAAGCCTGGC -3'
(R):5'- CATGCAATGCTGAGAAGTAAGC -3'

Sequencing Primer
(F):5'- AGTAACTCCAGTGGCTTG -3'
(R):5'- CAAGACTTGGGGTCAGCTTGC -3'
Posted On2016-09-06